Morpholino

MO1-hoxd4a

ID
ZDB-MRPHLNO-130509-3
Name
MO1-hoxd4a
Previous Names
  • MO1 (1)
Target
Sequence
5' - GTTCACTGTGAAGGACAAAATCACA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hoxd4a
Expressed Gene Anatomy Figures
cdx4 Fig. 9 with image,  Fig. 10 with image from Amali et al., 2013
efnb2a Fig. 5 with image from Amali et al., 2013
ephb4a Fig. 5 with image from Amali et al., 2013
fli1 Fig. 1,  Fig. 2 from Zhang et al., 2020
Fig. 5 with image,  Fig. 8 with image from Amali et al., 2013
gata1a Fig. 2 with image,  Fig. 3 with image,  Fig. 8 with image from Amali et al., 2013
hbbe1.1 Fig. 2 with image,  Fig. 3 with image from Amali et al., 2013
hoxa9a Fig. 10 with image from Amali et al., 2013
hoxa10b Fig. 10 with image from Amali et al., 2013
hoxb1a Fig. 10 with image from Amali et al., 2013
hoxb3a Fig. 10 with image from Amali et al., 2013
hoxb4a Fig. 10 with image from Amali et al., 2013
hoxb5a Fig. 10 with image from Amali et al., 2013
hoxb6b Fig. 10 with image from Amali et al., 2013
hoxb7a Fig. 10 with image from Amali et al., 2013
hoxb8a Fig. 10 with image from Amali et al., 2013
hoxc4a Fig. 10 with image from Amali et al., 2013
hoxc5a Fig. 10 with image from Amali et al., 2013
hoxc6a Fig. 10 with image from Amali et al., 2013
hoxc8a Fig. 10 with image from Amali et al., 2013
hoxc9a Fig. 10 with image from Amali et al., 2013
hoxd3a Fig. 10 with image from Amali et al., 2013
hoxd4a Fig. 9 with image from Amali et al., 2013
hoxd10a Fig. 10 with image from Amali et al., 2013
kdr Fig. 5 with image from Amali et al., 2013
lmo2 Fig. 5 with image,  Fig. 6 with image from Amali et al., 2013
meis1b Fig. 8 with image,  Fig. 9 with image,  Fig. 10 with image from Amali et al., 2013
myb Fig. 3 with image from Amali et al., 2013
runx1 Fig. 3 with image from Amali et al., 2013
tal1 Fig. 1,  Fig. 2 from Zhang et al., 2020
Fig. 5 with image,  Fig. 6 with image,  Fig. 8 with image from Amali et al., 2013
vegfaa Fig. 5 with image from Amali et al., 2013
Phenotype
Phenotype resulting from MO1-hoxd4a
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO1-hoxd4a Fig. 4 with image from Amali et al., 2013
caudal vein plexus aplastic, abnormal y1Tg + MO1-hoxd4a Fig. 4 with image from Amali et al., 2013
definitive hemopoiesis disrupted, abnormal AB + MO1-hoxd4a Fig. 3 with image from Amali et al., 2013
intersegmental vessel malformed, abnormal WT + MO1-hoxd4a Fig. 1,  Fig. 2 from Zhang et al., 2020
nucleate erythrocyte decreased amount, abnormal hoxd4azf3363/zf3363 + MO1-hoxd4a Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Zhang et al., 2020
posterior lateral mesoderm tal1 expression decreased amount, abnormal WT + MO1-hoxd4a Fig. 1,  Fig. 2 from Zhang et al., 2020
posterior lateral mesoderm fli1 expression decreased amount, abnormal WT + MO1-hoxd4a Fig. 1,  Fig. 2 from Zhang et al., 2020
primitive hemopoiesis disrupted, abnormal AB + MO1-hoxd4a Fig. 2 with image,  Fig. 3 with image from Amali et al., 2013
subintestinal vein aplastic, abnormal AB + MO1-hoxd4a Fig. 4 with image from Amali et al., 2013
subintestinal venous plexus malformed, abnormal WT + MO1-hoxd4a Fig. 1,  Fig. 2 from Zhang et al., 2020
vasculature lacks parts or has fewer parts of type intersegmental vessel, abnormal AB + MO1-hoxd4a Fig. 4 with image from Amali et al., 2013
vasculogenesis disrupted, abnormal y1Tg + MO1-hoxd4a Fig. 4 with image from Amali et al., 2013
vertebral artery aplastic, abnormal AB + MO1-hoxd4a Fig. 4 with image from Amali et al., 2013
whole organism tal1 expression decreased amount, abnormal WT + MO1-hoxd4a Fig. 2 from Zhang et al., 2020
whole organism fli1 expression decreased amount, abnormal WT + MO1-hoxd4a Fig. 2 from Zhang et al., 2020
Phenotype of all Fish created by or utilizing MO1-hoxd4a
Phenotype Fish Conditions Figures
nucleate erythrocyte decreased amount, abnormal hoxd4azf3363/zf3363 + MO1-hoxd4a standard conditions Fig. 6 from Zhang et al., 2020
vertebral artery aplastic, abnormal AB + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
vasculature lacks parts or has fewer parts of type intersegmental vessel, abnormal AB + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
primitive hemopoiesis disrupted, abnormal AB + MO1-hoxd4a standard conditions Fig. 2 with image,  Fig. 3 with image from Amali et al., 2013
definitive hemopoiesis disrupted, abnormal AB + MO1-hoxd4a standard conditions Fig. 3 with image from Amali et al., 2013
subintestinal vein aplastic, abnormal AB + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
whole organism tal1 expression decreased amount, abnormal WT + MO1-hoxd4a control Fig. 2 from Zhang et al., 2020
posterior lateral mesoderm fli1 expression decreased amount, abnormal WT + MO1-hoxd4a control Fig. 1,  Fig. 2 from Zhang et al., 2020
intersegmental vessel malformed, abnormal WT + MO1-hoxd4a control Fig. 1,  Fig. 2 from Zhang et al., 2020
subintestinal venous plexus malformed, abnormal WT + MO1-hoxd4a control Fig. 1,  Fig. 2 from Zhang et al., 2020
whole organism fli1 expression decreased amount, abnormal WT + MO1-hoxd4a control Fig. 2 from Zhang et al., 2020
posterior lateral mesoderm tal1 expression decreased amount, abnormal WT + MO1-hoxd4a control Fig. 1,  Fig. 2 from Zhang et al., 2020
nucleate erythrocyte decreased amount, abnormal WT + MO1-hoxd4a standard conditions Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Zhang et al., 2020
caudal vein plexus aplastic, abnormal y1Tg + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
vasculogenesis disrupted, abnormal y1Tg + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
angiogenesis disrupted, abnormal y1Tg + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.