Morpholino

MO1-myod1

ID

ZDB-MRPHLNO-070118-1

Name

MO1-myod1

Previous Names

MO1-myod

Target

myod1 (1)

Sequence

5' - ATATCCGACAACTCCATCTTTTTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-myod1

Expressed Gene	Anatomy	Figures
acta1b	adaxial cell segmental plate somite	Fig. 1 , Fig. 3 from Hinits et al., 2009
cdkn1ca	adaxial cell somite tail bud	Fig. 4 from Osborn et al., 2011
cited4b	adaxial cell	Fig. 1 from Devakanmalai et al., 2013
en1a	somite	Fig. 7 from Hinits et al., 2009
en2a	(not) adaxial cell somite	Fig. 2 from Osborn et al., 2011 Fig. 7 from Hinits et al., 2009
fgf8a	somite	Fig. 6 from Hammond et al., 2007
hsp90aa1.1	fast muscle myoblast slow muscle myoblast somite	Fig. 3 from Hinits et al., 2009
lbx2	pectoral fin musculature	Fig. 3 from Hinits et al., 2009
mef2ca	adaxial cell	Fig. 3 from Hinits et al., 2009
mef2d	adaxial cell somite	Fig. 4 from Hinits et al., 2009
meox1	fast muscle myoblast	Fig. 3 from Hinits et al., 2009
met	dorsal oblique extraocular muscle hyoid muscle hypaxialis pectoral fin musculature ventral oblique extraocular muscle	Fig. 7 , Fig. 8 from Lin et al., 2006
msc	head muscle	Fig. 6 from Lee et al., 2011
myf5	adaxial cell cephalic musculature constrictor dorsalis dorsal oblique extraocular muscle dorsal rectus epaxial myotome region hyoid muscle hypaxial myotome region (not) lateral rectus pectoral fin musculature pharyngeal arch segmental plate somite ventral oblique extraocular muscle	Fig. 1 , Fig. 3 , Fig. 7 from Hinits et al., 2009 Fig. 2 , Fig. 4 , Fig. 6 from Lin et al., 2006
myf6	adaxial cell fast muscle cell somite	Fig. 1 , Fig. 5 from Hinits et al., 2009 Fig. 3 from Schnapp et al., 2009
myhz1.1	(not) cephalic musculature fast muscle cell somite	Fig. 6 from Osborn et al., 2011 Fig. 3 , Fig. 4 , Fig. 7 from Hinits et al., 2009
mylpfa	fast muscle cell head muscle hyohyoideus interhyoideus	Fig. 6 from Osborn et al., 2011 Fig. 4 from Hinits et al., 2009 Fig. 6 from Hammond et al., 2007
myod1	adaxial cell segmental plate (not) somite	Fig. 1 from Hinits et al., 2009 Fig. 7 from Schnapp et al., 2009 Fig. 6 from Hammond et al., 2007
myog	adaxial cell cephalic musculature epaxial myotome region esophagus skeletal muscle cell fast muscle cell hyoid muscle hypaxial myotome region hypaxialis pectoral fin musculature somite	Fig. 4 from Minchin et al., 2013 Fig. 2 from Osborn et al., 2011 Fig. 1 , Fig. 3 , Fig. 5 from Hinits et al., 2009 Fig. 3 from Schnapp et al., 2009 Fig. 4 , Fig. 6 , Fig. 8 from Lin et al., 2006
noto	axis	Fig. 7 from Lin et al., 2013
pax3a	somite	Fig. 7 from Hammond et al., 2007
pax7a	somite	Fig. 7 from Hammond et al., 2007
prdm1a	adaxial cell	Fig. 3 from Hinits et al., 2009
ptch2	adaxial cell	Fig. 3 from Hinits et al., 2009
smyhc1	adaxial cell slow muscle cell somite	Fig. 4 from Osborn et al., 2011 Fig. 1 , Fig. 3 from Hinits et al., 2009
tcf21	head muscle	Fig. 6 from Lee et al., 2011
tpma	adaxial cell somite	Fig. 1 , Fig. 3 , Fig. 4 from Hinits et al., 2009
twist2	sclerotome	Fig. 4 from Hinits et al., 2009

Phenotype

Phenotype resulting from MO1-myod1

Phenotype	Fish	Figures
cephalic musculature aplastic, abnormal	WT + MO1-myod1	Fig. 3 from Hinits et al., 2009
cephalic musculature decreased amount, abnormal	WT + MO1-myod1	Fig. 4 , Fig. 7 , Fig. 8 from Lin et al., 2006
esophagus skeletal muscle cell poorly differentiated, abnormal	WT + MO1-myod1	Fig. 4 from Minchin et al., 2013
fast muscle cell decreased amount, abnormal	WT + MO1-myod1	Fig. 6 from Osborn et al., 2011
head decreased size, abnormal	twu3Tg + MO1-myod1	Fig. 1 from Lin et al., 2013
head lacks parts or has fewer parts of type cephalic musculature, abnormal	twu3Tg + MO1-myod1	Fig. 1 from Lin et al., 2013
head muscle hypoplastic, abnormal	WT + MO1-myod1	Fig. 6 from Osborn et al., 2011
head muscle poorly differentiated, abnormal	WT + MO1-myod1	Fig. 4 from Minchin et al., 2013
skeletal muscle tissue development delayed, abnormal	WT + MO1-myod1	Fig. 2 from Osborn et al., 2011

Phenotype of all Fish created by or utilizing MO1-myod1

Phenotype	Fish	Conditions	Figures
fast muscle cell decreased amount, abnormal	WT + MO1-myod1	standard conditions	Fig. 6 from Osborn et al., 2011
cephalic musculature aplastic, abnormal	WT + MO1-myod1	standard conditions	Fig. 3 from Hinits et al., 2009
head muscle poorly differentiated, abnormal	WT + MO1-myod1	standard conditions	Fig. 4 from Minchin et al., 2013
head muscle hypoplastic, abnormal	WT + MO1-myod1	standard conditions	Fig. 6 from Osborn et al., 2011
cephalic musculature decreased amount, abnormal	WT + MO1-myod1	standard conditions	Fig. 4 , Fig. 7 , Fig. 8 from Lin et al., 2006
esophagus skeletal muscle cell poorly differentiated, abnormal	WT + MO1-myod1	standard conditions	Fig. 4 from Minchin et al., 2013
skeletal muscle tissue development delayed, abnormal	WT + MO1-myod1	standard conditions	Fig. 2 from Osborn et al., 2011
head decreased size, abnormal	twu3Tg + MO1-myod1	standard conditions	Fig. 1 from Lin et al., 2013
head lacks parts or has fewer parts of type cephalic musculature, abnormal	twu3Tg + MO1-myod1	standard conditions	Fig. 1 from Lin et al., 2013
fast muscle cell decreased amount, abnormal	myf5^{hu2022/hu2022} + MO1-myod1	standard conditions	Fig. 6 from Osborn et al., 2011
skeletal muscle tissue development arrested, abnormal	shha^{tbx392/tbx392} + MO1-myod1	standard conditions	Fig. 2 from Osborn et al., 2011
muscle sarcomere disorganized, abnormal	AB + MO1-myf5 + MO1-myod1	standard conditions	Fig. 5 from Schnapp et al., 2009
muscle disorganized, abnormal	AB + MO1-myf5 + MO1-myod1	standard conditions	Fig. 5 from Schnapp et al., 2009
whole organism movement quality, abnormal	AB + MO1-myf5 + MO1-myod1	standard conditions	Fig. 1 from Schnapp et al., 2009
muscle sarcomere disoriented, abnormal	AB + MO1-myf5 + MO1-myod1	standard conditions	Fig. 5 from Schnapp et al., 2009
muscle apoptotic, abnormal	AB + MO1-myf5 + MO1-myod1	standard conditions	Fig. 5 from Schnapp et al., 2009
cephalic musculature decreased amount, abnormal	WT + MO1-myf5 + MO1-myod1	standard conditions	Fig. 5 from Lin et al., 2006
fast muscle cell absent, abnormal	WT + MO1-myod1 + MO1-myog	standard conditions	Fig. 6 from Hinits et al., 2009
fast muscle cell decreased amount, abnormal	WT + MO1-myod1 + MO3-cdkn1ca	standard conditions	Fig. 6 from Osborn et al., 2011
head muscle hypoplastic, abnormal	WT + MO1-myod1 + MO3-cdkn1ca	standard conditions	Fig. 6 from Osborn et al., 2011
somite nucleus apoptotic, abnormal	WT + MO1-myod1 + MO3-myf5	standard conditions	Fig. 7 from Hammond et al., 2007
fast muscle cell muscle cell development decreased process quality, abnormal	WT + MO1-myod1 + MO3-myf5	standard conditions	Fig. 4 from Nord et al., 2013
slow muscle cell muscle cell development decreased process quality, abnormal	WT + MO1-myod1 + MO3-myf5	standard conditions	Fig. 4 from Nord et al., 2013
ceratohyal cartilage chondrocyte morphology, abnormal	WT + MO1-myod1 + MO3-myf5	standard conditions	Fig. 3 from Shwartz et al., 2012
embryonic cranial skeleton morphogenesis disrupted, abnormal	WT + MO1-myod1 + MO3-myf5	standard conditions	Fig. 1 from Shwartz et al., 2012
ceratohyal cartilage chondrocyte decreased size, abnormal	WT + MO1-myod1 + MO3-myf5	standard conditions	Fig. 3 from Shwartz et al., 2012
ceratohyal cartilage decreased length, abnormal	WT + MO1-myod1 + MO3-myf5	standard conditions	Fig. 1 from Shwartz et al., 2012
chondrocyte stacked, abnormal	WT + MO1-myod1 + MO3-myf5	standard conditions	Fig. 3 from Shwartz et al., 2012
muscle aplastic, abnormal	myf5^{hu2022/hu2022} + MO1-myod1 + MO1-myog	standard conditions	Fig. 6 from Hinits et al., 2009
fast muscle cell absent, abnormal	myf5^{hu2022/hu2022} + MO1-myod1 + MO3-cdkn1ca	standard conditions	Fig. 6 from Osborn et al., 2011
fast muscle cell absent, abnormal	zf13Tg + MO1-myod1 + MO1-myog	standard conditions	Fig. 6 from Hinits et al., 2009

Citations