Morpholino

MO1-pard3ab

ID
ZDB-MRPHLNO-070717-1
Name
MO1-pard3ab
Previous Names
  • MO1-pard3
Target
Sequence
5' - TCAAAGGCTCCCGTGCTCTGGTGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
designed to bind to 5' UTR sequence
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pard3ab
Expressed Gene Anatomy Figures
amotl2a Fig. 2 with image from Hultin et al., 2017
foxd3 Fig. 2 with image from Moore et al., 2013
ift88 Fig. 6 with image from Krock et al., 2014
mbpa Fig. 4 from Tep et al., 2012
pard3ab Fig. 2 with image from Krock et al., 2014
Fig. 2 with image,  Fig. 3 with image from Wei et al., 2004
rho Fig. 7 with image,  Fig. 9 with image from Krock et al., 2014
spaw Fig. 12 with image from Krock et al., 2014
Phenotype
Phenotype resulting from MO1-pard3ab
Phenotype Fish Figures
blood circulation disrupted, abnormal s843Tg; sd2Tg + MO1-pard3ab Fig. 1 with image from Hultin et al., 2017
brain edematous, abnormal s843Tg; sd2Tg + MO1-pard3ab Fig. 1 with image from Hultin et al., 2017
brain hydrocephalic, abnormal AB + MO1-pard3ab Fig. 6 with image from Hong et al., 2010
brain malformed, abnormal WT + MO1-pard3ab Fig. S3 from Tawk et al., 2007
camera-type eye photoreceptor cell differentiation decreased occurrence, abnormal AB/EKW + MO1-pard3ab Fig. 9 with image from Krock et al., 2014
cell death increased occurrence, abnormal AB + MO1-pard3ab Fig. 5 with image from Wei et al., 2004
central nervous system myelination process quality, abnormal vu12Tg; vu234Tg + MO1-pard3ab text only from Tep et al., 2012
determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal AB/EKW + MO1-pard3ab Fig. 12 with image from Krock et al., 2014
diencephalon ventral region structure, abnormal AB + MO1-pard3ab Fig. 5 with image from Wei et al., 2004
dorsal aorta decreased diameter, abnormal y1Tg + MO1-pard3ab Fig. 1 with image from Hultin et al., 2017
dorsal aorta blood vessel lumenization disrupted, abnormal y1Tg + MO1-pard3ab Fig. 1 with image from Hultin et al., 2017
epidermis cell-cell junction amotl2a expression decreased amount, abnormal s843Tg; sd2Tg + MO1-pard3ab Fig. 2 with image from Hultin et al., 2017
establishment or maintenance of epithelial cell apical/basal polarity disrupted, abnormal AB + MO1-pard3ab Fig. 3 with image from Wei et al., 2004
eye decreased distance eye, abnormal AB + MO1-pard3ab Fig. 5 with image,  Fig. 6 with image from Wei et al., 2004
eye fused with eye, abnormal AB + MO1-pard3ab Fig. 7 with image from Wei et al., 2004
eye malformed, abnormal WT + MO1-pard3ab Fig. S3 from Tawk et al., 2007
eye photoreceptor cell has fewer parts of type eye photoreceptor cell photoreceptor connecting cilium, abnormal AB/EKW + MO1-pard3ab Fig. 6 with image from Krock et al., 2014
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor outer segment, abnormal AB/EKW + MO1-pard3ab Fig. 5 with image from Krock et al., 2014
eye photoreceptor cell apical region decreased area, abnormal AB/EKW + MO1-pard3ab Fig. 3 with image from Krock et al., 2014
eye photoreceptor cell apical region decreased length, abnormal AB/EKW + MO1-pard3ab Fig. 4 with image,  Fig. 8 with image from Krock et al., 2014
eye photoreceptor cell establishment of apical/basal cell polarity decreased process quality, abnormal AB/EKW + MO1-pard3ab Fig. 4 with image from Krock et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal AB/EKW + MO1-pard3ab Fig. 12 with image from Krock et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal AB/EKW + MO1-pard3ab Fig. 12 with image from Krock et al., 2014
myelinating Schwann cell loose, abnormal vu12Tg; vu234Tg + MO1-pard3ab Fig. 4 from Tep et al., 2012
myelinating Schwann cell mislocalised, abnormal vu12Tg; vu234Tg + MO1-pard3ab Fig. 4 from Tep et al., 2012
myelination in peripheral nervous system process quality, abnormal vu12Tg; vu234Tg + MO1-pard3ab Fig. 4 from Tep et al., 2012
neural crest cell migration decreased process quality, abnormal ba2Tg + MO1-pard3ab Fig. 2 with image from Moore et al., 2013
neural crest cell migration process quality, abnormal ba2Tg + MO1-pard3ab Fig. 5 with image from Moore et al., 2013
neural rod axoneme irregular spatial pattern, abnormal AB + MO1-pard3ab Fig. 5 with image from Hong et al., 2010
neural rod centrosome mislocalised, abnormal AB + MO1-pard3ab Fig. 4 with image from Hong et al., 2010
neural tube centrosome mislocalised, abnormal AB + MO1-pard3ab Fig. 4 with image from Hong et al., 2010
nucleate erythrocyte increased accumulation pericardium, abnormal s843Tg; sd2Tg + MO1-pard3ab Fig. 1 with image from Hultin et al., 2017
oligodendrocyte loose, abnormal vu12Tg; vu234Tg + MO1-pard3ab text only from Tep et al., 2012
pericardium edematous, abnormal AB + MO1-pard3ab Fig. 1 with image from Hultin et al., 2017
Fig. 6 with image from Wei et al., 2004
photoreceptor cell photoreceptor inner segment physical object quality, abnormal AB/EKW + MO1-pard3ab Fig. 7 with image from Krock et al., 2014
photoreceptor cell photoreceptor outer segment decreased length, abnormal AB/EKW + MO1-pard3ab Fig. 7 with image,  Fig. 9 with image from Krock et al., 2014
photoreceptor cell morphogenesis decreased process quality, abnormal AB/EKW + MO1-pard3ab Fig. 8 with image from Krock et al., 2014
retina disorganized, abnormal AB + MO1-pard3ab Fig. 7 with image from Wei et al., 2004
retina has fewer parts of type retinal rod cell, abnormal AB/EKW + MO1-pard3ab Fig. 9 with image from Krock et al., 2014
retina morphology, abnormal AB + MO1-pard3ab Fig. 3 with image from Wei et al., 2004
retina layer formation disrupted, abnormal AB + MO1-pard3ab Fig. 7 with image,  Fig. 8 with image from Wei et al., 2004
retinal cone cell decreased amount, abnormal AB + MO1-pard3ab Fig. 8 with image from Wei et al., 2004
retinal pigmented epithelium patchy, abnormal AB + MO1-pard3ab Fig. 5 with image from Krock et al., 2014
Fig. 6 with image from Wei et al., 2004
trunk neural crest cell migration decreased process quality, abnormal WT + MO1-pard3ab Fig. 2 with image from Moore et al., 2013
Phenotype of all Fish created by or utilizing MO1-pard3ab
Phenotype Fish Conditions Figures
retinal cone cell decreased amount, abnormal AB + MO1-pard3ab standard conditions Fig. 8 with image from Wei et al., 2004
pericardium edematous, abnormal AB + MO1-pard3ab standard conditions Fig. 6 with image from Wei et al., 2004
cell death increased occurrence, abnormal AB + MO1-pard3ab standard conditions Fig. 5 with image from Wei et al., 2004
neural rod centrosome mislocalised, abnormal AB + MO1-pard3ab standard conditions Fig. 4 with image from Hong et al., 2010
retinal pigmented epithelium patchy, abnormal AB + MO1-pard3ab standard conditions Fig. 6 with image from Wei et al., 2004
eye decreased distance eye, abnormal AB + MO1-pard3ab standard conditions Fig. 5 with image,  Fig. 6 with image from Wei et al., 2004
retina disorganized, abnormal AB + MO1-pard3ab standard conditions Fig. 7 with image from Wei et al., 2004
eye fused with eye, abnormal AB + MO1-pard3ab standard conditions Fig. 7 with image from Wei et al., 2004
retina morphology, abnormal AB + MO1-pard3ab standard conditions Fig. 3 with image from Wei et al., 2004
diencephalon ventral region structure, abnormal AB + MO1-pard3ab standard conditions Fig. 5 with image from Wei et al., 2004
neural rod axoneme irregular spatial pattern, abnormal AB + MO1-pard3ab standard conditions Fig. 5 with image from Hong et al., 2010
brain hydrocephalic, abnormal AB + MO1-pard3ab standard conditions Fig. 6 with image from Hong et al., 2010
establishment or maintenance of epithelial cell apical/basal polarity disrupted, abnormal AB + MO1-pard3ab standard conditions Fig. 3 with image from Wei et al., 2004
retina layer formation disrupted, abnormal AB + MO1-pard3ab standard conditions Fig. 7 with image,  Fig. 8 with image from Wei et al., 2004
neural tube centrosome mislocalised, abnormal AB + MO1-pard3ab standard conditions Fig. 4 with image from Hong et al., 2010
Kupffer's vesicle motile cilium decreased length, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 12 with image from Krock et al., 2014
eye photoreceptor cell apical region decreased length, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 4 with image,  Fig. 8 with image from Krock et al., 2014
eye photoreceptor cell has fewer parts of type eye photoreceptor cell photoreceptor connecting cilium, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 6 with image from Krock et al., 2014
photoreceptor cell photoreceptor outer segment decreased length, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 7 with image,  Fig. 9 with image from Krock et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 12 with image from Krock et al., 2014
eye photoreceptor cell apical region decreased area, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 3 with image from Krock et al., 2014
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor outer segment, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 5 with image from Krock et al., 2014
eye photoreceptor cell establishment of apical/basal cell polarity decreased process quality, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 4 with image from Krock et al., 2014
determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 12 with image from Krock et al., 2014
retina has fewer parts of type retinal rod cell, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 9 with image from Krock et al., 2014
photoreceptor cell photoreceptor inner segment physical object quality, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 7 with image from Krock et al., 2014
camera-type eye photoreceptor cell differentiation decreased occurrence, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 9 with image from Krock et al., 2014
retinal pigmented epithelium patchy, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 5 with image from Krock et al., 2014
photoreceptor cell morphogenesis decreased process quality, abnormal AB/EKW + MO1-pard3ab standard conditions Fig. 8 with image from Krock et al., 2014
brain malformed, abnormal WT + MO1-pard3ab standard conditions Fig. S3 from Tawk et al., 2007
eye malformed, abnormal WT + MO1-pard3ab standard conditions Fig. S3 from Tawk et al., 2007
trunk neural crest cell migration decreased process quality, abnormal WT + MO1-pard3ab standard conditions Fig. 2 with image from Moore et al., 2013
neural crest cell migration process quality, abnormal ba2Tg + MO1-pard3ab standard conditions Fig. 5 with image from Moore et al., 2013
neural crest cell migration decreased process quality, abnormal ba2Tg + MO1-pard3ab standard conditions Fig. 2 with image from Moore et al., 2013
dorsal aorta blood vessel lumenization disrupted, abnormal y1Tg + MO1-pard3ab standard conditions Fig. 1 with image from Hultin et al., 2017
dorsal aorta decreased diameter, abnormal y1Tg + MO1-pard3ab standard conditions Fig. 1 with image from Hultin et al., 2017
blood circulation disrupted, abnormal s843Tg; sd2Tg + MO1-pard3ab standard conditions Fig. 1 with image from Hultin et al., 2017
nucleate erythrocyte increased accumulation pericardium, abnormal s843Tg; sd2Tg + MO1-pard3ab standard conditions Fig. 1 with image from Hultin et al., 2017
epidermis cell-cell junction amotl2a expression decreased amount, abnormal s843Tg; sd2Tg + MO1-pard3ab standard conditions Fig. 2 with image from Hultin et al., 2017
pericardium edematous, abnormal s843Tg; sd2Tg + MO1-pard3ab standard conditions Fig. 1 with image from Hultin et al., 2017
brain edematous, abnormal s843Tg; sd2Tg + MO1-pard3ab standard conditions Fig. 1 with image from Hultin et al., 2017
central nervous system myelination process quality, abnormal vu12Tg; vu234Tg + MO1-pard3ab standard conditions text only from Tep et al., 2012
myelination in peripheral nervous system process quality, abnormal vu12Tg; vu234Tg + MO1-pard3ab standard conditions Fig. 4 from Tep et al., 2012
myelinating Schwann cell mislocalised, abnormal vu12Tg; vu234Tg + MO1-pard3ab standard conditions Fig. 4 from Tep et al., 2012
oligodendrocyte loose, abnormal vu12Tg; vu234Tg + MO1-pard3ab standard conditions text only from Tep et al., 2012
myelinating Schwann cell loose, abnormal vu12Tg; vu234Tg + MO1-pard3ab standard conditions Fig. 4 from Tep et al., 2012
determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal AB/EKW + MO1-pard3ab + MO1-prkci standard conditions Fig. 12 with image from Krock et al., 2014
gut apical plasma membrane ab1-prkcz labeling decreased amount, abnormal mitfaw2/w2; mpv17a9/a9 + MO1-pard3ab control Fig. 6 with image from Abu-Siniyeh et al., 2016
swim bladder absent, abnormal mitfaw2/w2; mpv17a9/a9 + MO1-pard3ab standard conditions Fig. S8 with image from Abu-Siniyeh et al., 2016
heart edematous, abnormal mitfaw2/w2; mpv17a9/a9 + MO1-pard3ab standard conditions Fig. S8 with image from Abu-Siniyeh et al., 2016
kidney epithelial cell apical plasma membrane ab1-prkcz labeling decreased amount, abnormal mitfaw2/w2; mpv17a9/a9 + MO1-pard3ab control Fig. 6 with image from Abu-Siniyeh et al., 2016
liver apical plasma membrane ab1-prkcz labeling decreased amount, abnormal mitfaw2/w2; mpv17a9/a9 + MO1-pard3ab control Fig. 6 with image from Abu-Siniyeh et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.