Morpholino

MO4-tal1

ID
ZDB-MRPHLNO-050527-2
Name
MO4-tal1
Previous Names
  • SclMO (1)
  • scl E2/IMO (1)
  • scl spliceMO (1)
Target
Sequence
5' - AATGCTCTTACCATCGTTGATTTCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets exon/intron boundary sequence of exon 3/intron 3.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tal1
Expressed Gene Anatomy Figures
alas2 text only from Patterson et al., 2005
desma Fig. 3 from Patterson et al., 2005
dlc Fig. 6 from Patterson et al., 2005
drl Fig. 4Fig. 5 from Patterson et al., 2005
efnb2a Fig. 6 from Patterson et al., 2005
ephb4a Fig. 6 from Patterson et al., 2005
fli1 Fig. 4Fig. 5Fig. 6 from Patterson et al., 2005
flt4 Fig. 6Fig. 7 from Patterson et al., 2007
Fig. 6 from Patterson et al., 2005
gata1a Fig. 6Fig. 7 from Patterson et al., 2007
Fig. 2Fig. 3Fig. 4 from Patterson et al., 2005
gata2a Fig. 4 from Patterson et al., 2005
gata4 Fig. 4 with image from Peterkin et al., 2009
gata5 Fig. 4 with image from Peterkin et al., 2009
gata6 Fig. 4 with image from Peterkin et al., 2009
hbae3 Fig. 5 with image from Glenn et al., 2014
hbbe1.1 Fig. 2 from Patterson et al., 2005
hhex Fig. 4Fig. 5 from Patterson et al., 2005
ikzf1 Fig. 2 from Patterson et al., 2005
kdrl Fig. 4 with image from Liu et al., 2008
Fig. 6 from Patterson et al., 2005
klf17 Fig. 4 from Patterson et al., 2005
lcp1 Fig. 2 from Patterson et al., 2005
lmo2 Fig. 4Fig. 5 from Patterson et al., 2005
mpx Fig. 5 with image from Glenn et al., 2014
Fig. 2 from Patterson et al., 2005
mybl2a Fig. 2 from Patterson et al., 2005
myl7 Fig. 4 with image from Capon et al., 2022
nkx2.4b Fig. 2 with imagetext only from Alt et al., 2006
nkx2.5 Fig. 4 from Yin et al., 2020
Fig. 3 from Patterson et al., 2005
notch3 Fig. 6 from Patterson et al., 2005
npas4l Fig. 4 from Reischauer et al., 2016
pax2a Fig. 3 from Patterson et al., 2005
runx1 Fig. 2Fig. 4 from Patterson et al., 2005
sox7 Fig. 2 from Cermenati et al., 2008
sox18 Fig. 2 from Cermenati et al., 2008
spi1b Fig. 4 with image from Capon et al., 2022
Fig. 4 with image from Peterkin et al., 2009
Fig. 6Fig. 7 from Patterson et al., 2007
Fig. 2Fig. 3Fig. 5 from Patterson et al., 2005
tbx20 Fig. 6 from Patterson et al., 2005
tek Fig. 6 from Patterson et al., 2005
tie1 Fig. 2 with image from Alt et al., 2006
Fig. 6 from Patterson et al., 2005
Phenotype
Phenotype resulting from MO4-tal1
Phenotype of all Fish created by or utilizing MO4-tal1
Phenotype Fish Conditions Figures
posterior lateral mesoderm morphology, abnormal AB + MO4-tal1 standard conditions Fig. 4 with image from Liu et al., 2008
embryonic hemopoiesis disrupted, abnormal AB + MO4-tal1 standard conditions Fig. 4 with image from Liu et al., 2008
endocardium myl7 expression spatial pattern, abnormal WT + MO4-tal1 standard conditions Fig. 4 with image from Capon et al., 2022
endocardium EGFP expression spatial pattern, abnormal WT + MO4-tal1 standard conditions Fig. 4 with image from Capon et al., 2022
myeloid cell absent, abnormal WT + MO4-tal1 standard conditions Fig. S6 with image from Hall et al., 2007
endocardium EGFP expression increased amount, abnormal WT + MO4-tal1 standard conditions Fig. 4 with image from Capon et al., 2022
endocardium myl7 expression increased amount, abnormal WT + MO4-tal1 standard conditions Fig. 4 with image from Capon et al., 2022
endocardium spi1b expression spatial pattern, abnormal WT + MO4-tal1 standard conditions Fig. 4 with image from Capon et al., 2022
heart edematous, abnormal WT + MO4-tal1 standard conditions Fig. S6 with image from Hall et al., 2007
endocardium spi1b expression increased amount, abnormal WT + MO4-tal1 standard conditions Fig. 4 with image from Capon et al., 2022
blood vasculature lacks parts or has fewer parts of type blood vessel, abnormal s843Tg + MO4-tal1 standard conditions Fig. S5 from Reischauer et al., 2016
caudal vein plexus EGFP expression decreased amount, abnormal s843Tg + MO4-tal1 standard conditions Fig. S5 from Reischauer et al., 2016
intersegmental vessel EGFP expression absent, abnormal s843Tg + MO4-tal1 standard conditions Fig. S5 from Reischauer et al., 2016
heart primordium nkx2.5 expression amount, ameliorated atf3zf3482/zf3482 + MO4-tal1 standard conditions Fig. 4 from Yin et al., 2020
atrium size, ameliorated atf3zf3482/zf3482; fb7Tg + MO4-tal1 standard conditions Fig. 4 from Yin et al., 2020
vascular endothelium mCherry expression spatial pattern, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 standard conditions Fig. 4 from Metikala et al., 2022
vascular endothelium damaged, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 chemical treatment by environment: metronidazole Fig. 4 from Metikala et al., 2022
vascular endothelium EGFP expression spatial pattern, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 chemical treatment by environment: metronidazole Fig. 4 from Metikala et al., 2022
vascular endothelium mCherry expression decreased amount, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 chemical treatment by environment: metronidazole Fig. 4 from Metikala et al., 2022
vascular endothelium mCherry expression spatial pattern, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 chemical treatment by environment: metronidazole Fig. 4 from Metikala et al., 2022
vascular endothelium EGFP expression spatial pattern, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 standard conditions Fig. 4 from Metikala et al., 2022
vascular endothelium morphogenesis of a branching structure decreased process quality, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 standard conditions Fig. 4 from Metikala et al., 2022
vascular endothelium EGFP expression decreased amount, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 standard conditions Fig. 4 from Metikala et al., 2022
vascular endothelium EGFP expression decreased amount, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 chemical treatment by environment: metronidazole Fig. 4 from Metikala et al., 2022
vascular endothelium regeneration decreased process quality, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 chemical treatment by environment: metronidazole Fig. 4 from Metikala et al., 2022
vascular endothelium mCherry expression decreased amount, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 standard conditions Fig. 4 from Metikala et al., 2022
Citations