Morpholino

MO1-arl6ip1

ID
ZDB-MRPHLNO-090316-1
Name
MO1-arl6ip1
Previous Names
  • arl6ip-MO1 (1)
Target
Sequence
5' - ACTTTTATTGTCGCCCTCAGCCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-arl6ip1
Expressed Gene Anatomy Figures
arl6ip1 Fig. 2 with image from Huang et al., 2009
bmp4 Fig. 4 with image from Tu et al., 2012
ccnd1 Fig. 4 from Huang et al., 2012
cdkn1ca Fig. 4 from Huang et al., 2012
crestin Fig. 6 with image,  Fig. 7 with image from Tu et al., 2012
dlx2a Fig. 2 with image from Tu et al., 2012
dlx3b Fig. 4 with image from Tu et al., 2012
foxd3 Fig. 5 with image from Tu et al., 2012
msx1b Fig. 4 with image from Tu et al., 2012
opn1lw2 Fig. 3 with image from Huang et al., 2009
pax3a Fig. 4 with image from Tu et al., 2012
phox2bb Fig. 7 with image from Tu et al., 2012
rho Fig. 3 with image from Huang et al., 2009
snai1b Fig. 5 with image from Tu et al., 2012
sox10 Fig. 5 with image from Tu et al., 2012
tfap2a Fig. 5 with image from Tu et al., 2012
wnt8a Fig. 4 with image from Tu et al., 2012
Phenotype
Phenotype resulting from MO1-arl6ip1
Phenotype Fish Figures
apoptotic process decreased occurrence, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. 8 with image from Tu et al., 2012
apoptotic process increased occurrence, abnormal AB + MO1-arl6ip1 Fig. 8 with image from Tu et al., 2012
camera-type eye development arrested, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
cilium assembly disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. S6 with image from Tu et al., 2012
cranial neural crest decreased size, abnormal AB + MO1-arl6ip1 Fig. 5 with image,  Fig. 6 with image from Tu et al., 2012
cranial neural crest cell mislocalised, abnormal AB + MO1-arl6ip1 Fig. 6 with image from Tu et al., 2012
determination of left/right symmetry disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. S6 with image from Tu et al., 2012
dorsal root ganglion neuron decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. 3 with image from Tu et al., 2012
enteric nervous system development disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. 7 with image from Tu et al., 2012
enteric neuron decreased amount, abnormal AB + MO1-arl6ip1 Fig. 3 with image from Tu et al., 2012
enteric neuron decreased length, abnormal AB + MO1-arl6ip1 Fig. 7 with image from Tu et al., 2012
enteric neuron mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. 7 with image from Tu et al., 2012
epibranchial ganglion neuron decreased amount, abnormal AB + MO1-arl6ip1 Fig. 3 with image from Tu et al., 2012
ethmoid cartilage absent, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Tu et al., 2012
extension decreased length, abnormal AB + MO1-arl6ip1 Fig. 1 with image from Tu et al., 2012
Fig. 2 with image from Huang et al., 2009
eye decreased size, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
eye morphology, abnormal AB + MO1-arl6ip1 Fig. 1 with image from Tu et al., 2012
gut morphology, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
head decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. 1 with image from Tu et al., 2012
head flat, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
heart looping disrupted, abnormal twu34Tg + MO1-arl6ip1 Fig. S1 with image from Huang et al., 2009
hindbrain morphology, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
iridophore decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. 1 with image from Tu et al., 2012
Kupffer's vesicle cilium decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. S6 with image from Tu et al., 2012
Kupffer's vesicle cilium decreased length, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. S6 with image from Tu et al., 2012
mandibular arch skeleton decreased size, abnormal AB + MO1-arl6ip1 Fig. 1 with image from Tu et al., 2012
melanocyte decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. 1 with image from Tu et al., 2012
melanocyte migration disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. 1 with image from Tu et al., 2012
motor neuron axon branched, abnormal WT + MO1-arl6ip1 Fig. S5 from Novarino et al., 2014
neural crest cell decreased amount, abnormal AB + MO1-arl6ip1 Fig. 8 with image from Tu et al., 2012
neural crest cell migration process quality, abnormal AB + MO1-arl6ip1 Fig. 6 with image from Tu et al., 2012
neural crest cell migration involved in autonomic nervous system development disrupted, abnormal AB + MO1-arl6ip1 Fig. 7 with image from Tu et al., 2012
neurocranial trabecula decreased size, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Tu et al., 2012
optic cup decreased size, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
optic tectum morphology, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
otic vesicle decreased size, abnormal AB + MO1-arl6ip1 Fig. 1 with image from Tu et al., 2012
pectoral fin absent, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Tu et al., 2012
pectoral fin morphology, abnormal AB + MO1-arl6ip1 Fig. 2 with image,  Fig. S2 with image from Huang et al., 2009
pectoral fin development disrupted, abnormal sb15Tg + MO1-arl6ip1 Fig. S2 with image from Huang et al., 2009
pericardium edematous, abnormal AB + MO1-arl6ip1 Fig. 1 with image from Tu et al., 2012
Fig. 2 with image from Huang et al., 2009
pharyngeal arch 3-7 morphology, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
pharyngeal arch cartilage absent, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Tu et al., 2012
pigment cell irregular spatial pattern, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
pigmentation disrupted, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
pneumatic duct morphology, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
post-vent region curved, abnormal WT + MO1-arl6ip1 Fig. S4 from Novarino et al., 2014
post-vent region curved dorsal, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
post-vent region decreased length, abnormal AB + MO1-arl6ip1 Fig. 1 with image from Tu et al., 2012
Fig. 2 with image from Huang et al., 2009
regulation of smoothened signaling pathway disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. S5 with image from Tu et al., 2012
retina decreased size, abnormal AB + MO1-arl6ip1 Fig. 3 with image from Huang et al., 2009
retina has fewer parts of type cell, abnormal WT + MO1-arl6ip1 Fig. 1 from Huang et al., 2012
retina morphology, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
retina apoptotic process decreased process quality, abnormal WT + MO1-arl6ip1 Fig. 1 from Huang et al., 2012
retina axon malformed, abnormal AB + MO1-arl6ip1 Fig. 3 with image from Huang et al., 2009
retina cell population proliferation process quality, abnormal WT + MO1-arl6ip1 Fig. 2 from Huang et al., 2012
retina exit from mitosis decreased process quality, abnormal WT + MO1-arl6ip1 Fig. 1 from Huang et al., 2012
retina mitotic cell cycle process quality, abnormal WT + MO1-arl6ip1 Fig. 1,  Fig. 2,  Fig. 3 from Huang et al., 2012
retina development in camera-type eye disrupted, abnormal AB + MO1-arl6ip1 Fig. 3 with image from Huang et al., 2009
retina layer formation disrupted, abnormal AB + MO1-arl6ip1 Fig. 3 with image from Huang et al., 2009
retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-arl6ip1 Fig. 3 with image from Huang et al., 2009
retinal bipolar neuron differentiation delayed, abnormal AB + MO1-arl6ip1 Fig. 3 with image from Huang et al., 2009
solid lens vesicle decreased size, abnormal AB + MO1-arl6ip1 Fig. 1 with image from Tu et al., 2012
somite border irregular spatial pattern, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
swim bladder morphology, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
trunk deformed, abnormal AB + MO1-arl6ip1 Fig. 2 with image from Huang et al., 2009
trunk neural crest cell mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 Fig. 6 with image from Tu et al., 2012
trunk neural crest cell migration delayed, abnormal AB + MO1-arl6ip1 Fig. 6 with image from Tu et al., 2012
vagal neural crest decreased size, abnormal AB + MO1-arl6ip1 Fig. 7 with image from Tu et al., 2012
Phenotype of all Fish created by or utilizing MO1-arl6ip1
Phenotype Fish Conditions Figures
somite border irregular spatial pattern, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
solid lens vesicle decreased size, abnormal AB + MO1-arl6ip1 standard conditions Fig. 1 with image from Tu et al., 2012
eye decreased size, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
pharyngeal arch 3-7 morphology, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
cranial neural crest decreased size, abnormal AB + MO1-arl6ip1 standard conditions Fig. 5 with image,  Fig. 6 with image from Tu et al., 2012
cranial neural crest cell mislocalised, abnormal AB + MO1-arl6ip1 standard conditions Fig. 6 with image from Tu et al., 2012
pneumatic duct morphology, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
head flat, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
melanocyte migration disrupted, abnormal AB + MO1-arl6ip1 standard conditions Fig. 1 with image from Tu et al., 2012
melanocyte decreased amount, abnormal AB + MO1-arl6ip1 standard conditions Fig. 1 with image from Tu et al., 2012
hindbrain morphology, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
head decreased size, abnormal AB + MO1-arl6ip1 standard conditions Fig. 1 with image from Tu et al., 2012
trunk neural crest cell migration delayed, abnormal AB + MO1-arl6ip1 standard conditions Fig. 6 with image from Tu et al., 2012
optic tectum morphology, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
neural crest cell decreased amount, abnormal AB + MO1-arl6ip1 standard conditions Fig. 8 with image from Tu et al., 2012
dorsal root ganglion neuron decreased amount, abnormal AB + MO1-arl6ip1 standard conditions Fig. 3 with image from Tu et al., 2012
neurocranial trabecula decreased size, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Tu et al., 2012
extension decreased length, abnormal AB + MO1-arl6ip1 standard conditions Fig. 1 with image from Tu et al., 2012
Fig. 2 with image from Huang et al., 2009
cell cycle disrupted, abnormal AB + MO1-arl6ip1 chemical treatment: 5-bromo-2'-deoxyuridine Fig. 3 with image from Huang et al., 2009
vagal neural crest decreased size, abnormal AB + MO1-arl6ip1 standard conditions Fig. 7 with image from Tu et al., 2012
pericardium edematous, abnormal AB + MO1-arl6ip1 standard conditions Fig. 1 with image from Tu et al., 2012
Fig. 2 with image from Huang et al., 2009
pigment cell irregular spatial pattern, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
retinal bipolar neuron differentiation disrupted, abnormal AB + MO1-arl6ip1 chemical treatment: 5-bromo-2'-deoxyuridine Fig. 3 with image from Huang et al., 2009
pectoral fin absent, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Tu et al., 2012
retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-arl6ip1 standard conditions Fig. 3 with image from Huang et al., 2009
apoptotic process increased occurrence, abnormal AB + MO1-arl6ip1 standard conditions Fig. 8 with image from Tu et al., 2012
retina layer formation disrupted, abnormal AB + MO1-arl6ip1 standard conditions Fig. 3 with image from Huang et al., 2009
enteric neuron mislocalised, abnormal AB + MO1-arl6ip1 standard conditions Fig. 7 with image from Tu et al., 2012
iridophore decreased amount, abnormal AB + MO1-arl6ip1 standard conditions Fig. 1 with image from Tu et al., 2012
swim bladder morphology, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
ethmoid cartilage absent, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Tu et al., 2012
mandibular arch skeleton decreased size, abnormal AB + MO1-arl6ip1 standard conditions Fig. 1 with image from Tu et al., 2012
enteric nervous system development disrupted, abnormal AB + MO1-arl6ip1 standard conditions Fig. 7 with image from Tu et al., 2012
retina development in camera-type eye disrupted, abnormal AB + MO1-arl6ip1 standard conditions Fig. 3 with image from Huang et al., 2009
retinal bipolar neuron differentiation delayed, abnormal AB + MO1-arl6ip1 standard conditions Fig. 3 with image from Huang et al., 2009
enteric neuron decreased amount, abnormal AB + MO1-arl6ip1 standard conditions Fig. 3 with image from Tu et al., 2012
pectoral fin morphology, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
trunk neural crest cell mislocalised, abnormal AB + MO1-arl6ip1 standard conditions Fig. 6 with image from Tu et al., 2012
pigmentation disrupted, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
pharyngeal arch cartilage absent, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Tu et al., 2012
enteric neuron decreased length, abnormal AB + MO1-arl6ip1 standard conditions Fig. 7 with image from Tu et al., 2012
epibranchial ganglion neuron decreased amount, abnormal AB + MO1-arl6ip1 standard conditions Fig. 3 with image from Tu et al., 2012
post-vent region curved dorsal, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
post-vent region decreased length, abnormal AB + MO1-arl6ip1 standard conditions Fig. 1 with image from Tu et al., 2012
Fig. 2 with image from Huang et al., 2009
eye morphology, abnormal AB + MO1-arl6ip1 standard conditions Fig. 1 with image from Tu et al., 2012
camera-type eye photoreceptor cell differentiation disrupted, abnormal AB + MO1-arl6ip1 chemical treatment: 5-bromo-2'-deoxyuridine Fig. 3 with image from Huang et al., 2009
gut morphology, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
otic vesicle decreased size, abnormal AB + MO1-arl6ip1 standard conditions Fig. 1 with image from Tu et al., 2012
retina morphology, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
retina axon malformed, abnormal AB + MO1-arl6ip1 standard conditions Fig. 3 with image from Huang et al., 2009
trunk deformed, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
camera-type eye development arrested, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
retina decreased size, abnormal AB + MO1-arl6ip1 standard conditions Fig. 3 with image from Huang et al., 2009
neural crest cell migration process quality, abnormal AB + MO1-arl6ip1 standard conditions Fig. 6 with image from Tu et al., 2012
optic cup decreased size, abnormal AB + MO1-arl6ip1 standard conditions Fig. 2 with image from Huang et al., 2009
neural crest cell migration involved in autonomic nervous system development disrupted, abnormal AB + MO1-arl6ip1 standard conditions Fig. 7 with image from Tu et al., 2012
Kupffer's vesicle cilium decreased length, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
enteric neuron mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
dorsal root ganglion neuron decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 3 with image from Tu et al., 2012
apoptotic process decreased occurrence, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 8 with image from Tu et al., 2012
head decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
iridophore decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
determination of left/right symmetry disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
pharyngeal arch cartilage absent, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
cranial neural crest cell mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
neurocranial trabecula decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
neural crest cell migration process quality, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
cilium assembly disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
trunk neural crest cell migration delayed, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
trunk neural crest cell mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
epibranchial ganglion neuron decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 3 with image from Tu et al., 2012
pectoral fin absent, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
enteric neuron decreased length, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
neural crest cell migration involved in autonomic nervous system development disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
mandibular arch skeleton decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
melanocyte migration disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
melanocyte decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
regulation of smoothened signaling pathway disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S5 with image from Tu et al., 2012
vagal neural crest decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
enteric neuron decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 3 with image from Tu et al., 2012
Kupffer's vesicle cilium decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
enteric nervous system development disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
ethmoid cartilage absent, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
cranial neural crest decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 5 with image,  Fig. 6 with image from Tu et al., 2012
retina exit from mitosis decreased process quality, abnormal WT + MO1-arl6ip1 standard conditions Fig. 1 from Huang et al., 2012
retina has fewer parts of type cell, abnormal WT + MO1-arl6ip1 standard conditions Fig. 1 from Huang et al., 2012
retina cell population proliferation process quality, abnormal WT + MO1-arl6ip1 standard conditions Fig. 2 from Huang et al., 2012
retina mitotic cell cycle process quality, abnormal WT + MO1-arl6ip1 standard conditions Fig. 1,  Fig. 2,  Fig. 3 from Huang et al., 2012
post-vent region curved, abnormal WT + MO1-arl6ip1 standard conditions Fig. S4 from Novarino et al., 2014
motor neuron axon branched, abnormal WT + MO1-arl6ip1 standard conditions Fig. S5 from Novarino et al., 2014
retina apoptotic process decreased process quality, abnormal WT + MO1-arl6ip1 standard conditions Fig. 1 from Huang et al., 2012
pectoral fin development disrupted, abnormal sb15Tg + MO1-arl6ip1 standard conditions Fig. S2 with image from Huang et al., 2009
pectoral fin morphology, abnormal sb15Tg + MO1-arl6ip1 standard conditions Fig. S2 with image from Huang et al., 2009
heart looping disrupted, abnormal twu34Tg + MO1-arl6ip1 standard conditions Fig. S1 with image from Huang et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.