Morpholino

MO2-sox32

ID
ZDB-MRPHLNO-051216-6
Name
MO2-sox32
Previous Names
  • sox32 ATG (1)
Target
Sequence
5' - CAGGGAGCATCCGGTCGAGATACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sox32
Expressed Gene Anatomy Figures
acta2 Fig. 1 with image from Reichenbach et al., 2008
crestin Fig. 1 with image from Reichenbach et al., 2008
dmrt2b Fig. 1 with image from Li et al., 2018
edn1 Fig. 4 with image from Dworkin et al., 2014
fn1a Fig. 10 with image from Wong et al., 2012
foxa2 Fig. 7 with image from Terashima et al., 2014
Fig. 10 with image from Mudumana et al., 2008
foxa3 Fig. 9 with image from Pietsch et al., 2006
gdnfa Fig. 10 with image from Reichenbach et al., 2008
hand2 Fig. 1 with image from Reichenbach et al., 2008
kdrl Fig. 10 with image from Wong et al., 2012
myh11a Fig. 1 with image from Reichenbach et al., 2008
myl7 Fig. 10 with image from Wong et al., 2012
nfatc1 Fig. 10 with image from Wong et al., 2012
nkx2.3 Fig. 1 with image from Li et al., 2018
osr1 Fig. 7 with image from Terashima et al., 2014
pax2a Fig. 11 with image from Mudumana et al., 2008
pdgfaa Fig. 1 from Mao et al., 2019
pdgfab Fig. 1 from Mao et al., 2019
phox2bb Fig. 1 with image from Reichenbach et al., 2008
Fig. 9 with image,  text only from Pietsch et al., 2006
sox17 Fig. 1 with image from Li et al., 2018
Fig. 7 with image from Terashima et al., 2014
spaw Fig. 3 with image from Wang et al., 2008
wt1a Fig. 5 with image from Serluca, 2008
Phenotype
Phenotype resulting from MO2-sox32
Phenotype Fish Figures
determination of left/right symmetry disrupted, abnormal WT + MO2-sox32 Fig. 3 with image from Wang et al., 2008
endocardial progenitor cell migration to the midline involved in heart field formation disrupted, abnormal WT + MO2-sox32 Fig. 10 with image from Wong et al., 2012
endocardium morphogenesis disrupted, abnormal WT + MO2-sox32 Fig. 10 with image from Wong et al., 2012
endoderm sox17 expression absent, abnormal TU + MO2-sox32 Fig. 1 with image from Li et al., 2018
endoderm morphology, abnormal AB/TU + MO2-sox32 Fig. 11 with image from Mudumana et al., 2008
endoderm development disrupted, abnormal AB/TU + MO2-sox32 Fig. 10 with image,  Fig. 11 with image from Mudumana et al., 2008
endodermal cell differentiation arrested, abnormal AB/TU + MO2-sox32 Fig. 7 with image from Terashima et al., 2014
heart cleft, abnormal WT + MO2-sox32 Fig. 5 with image from Serluca, 2008
hypoblast lacks all parts of type endodermal cell, abnormal AB/TU + MO2-sox32 Fig. 7 with image from Terashima et al., 2014
neural crest cell migration disrupted, abnormal WT + MO2-sox32 Fig. 1 with image from Reichenbach et al., 2008
pharyngeal arch pdgfab expression absent, abnormal WT + MO2-sox32 Fig. 1 from Mao et al., 2019
pharyngeal arch pdgfaa expression absent, abnormal WT + MO2-sox32 Fig. 1 from Mao et al., 2019
pharyngeal endoderm morphology, abnormal AB/TU + MO2-sox32 Fig. 10 with image from Mudumana et al., 2008
pharyngeal pouch dmrt2b expression absent, abnormal TU + MO2-sox32 Fig. 1 with image from Li et al., 2018
pharyngeal pouch nkx2.3 expression absent, abnormal TU + MO2-sox32 Fig. 1 with image from Li et al., 2018
primordial germ cell aggregated, abnormal s870Tg; s903Tg + MO2-sox32 Fig. 5 with image,  Fig. 6 with image from Paksa et al., 2016
pronephric tubule morphology, abnormal AB/TU + MO2-sox32 Fig. 11 with image from Mudumana et al., 2008
Phenotype of all Fish created by or utilizing MO2-sox32
Phenotype Fish Conditions Figures
pronephric tubule morphology, abnormal AB/TU + MO2-sox32 standard conditions Fig. 11 with image from Mudumana et al., 2008
endodermal cell differentiation arrested, abnormal AB/TU + MO2-sox32 standard conditions Fig. 7 with image from Terashima et al., 2014
hypoblast lacks all parts of type endodermal cell, abnormal AB/TU + MO2-sox32 standard conditions Fig. 7 with image from Terashima et al., 2014
endoderm morphology, abnormal AB/TU + MO2-sox32 standard conditions Fig. 11 with image from Mudumana et al., 2008
pharyngeal endoderm morphology, abnormal AB/TU + MO2-sox32 standard conditions Fig. 10 with image from Mudumana et al., 2008
endoderm development disrupted, abnormal AB/TU + MO2-sox32 standard conditions Fig. 10 with image,  Fig. 11 with image from Mudumana et al., 2008
pharyngeal pouch dmrt2b expression absent, abnormal TU + MO2-sox32 standard conditions Fig. 1 with image from Li et al., 2018
endoderm sox17 expression absent, abnormal TU + MO2-sox32 standard conditions Fig. 1 with image from Li et al., 2018
pharyngeal pouch nkx2.3 expression absent, abnormal TU + MO2-sox32 standard conditions Fig. 1 with image from Li et al., 2018
endocardial progenitor cell migration to the midline involved in heart field formation disrupted, abnormal WT + MO2-sox32 standard conditions Fig. 10 with image from Wong et al., 2012
pharyngeal arch pdgfab expression absent, abnormal WT + MO2-sox32 standard conditions Fig. 1 from Mao et al., 2019
primordial germ cell aggregated, abnormal WT + MO2-sox32 standard conditions Fig. 6 with image from Paksa et al., 2016
heart cleft, abnormal WT + MO2-sox32 standard conditions Fig. 5 with image from Serluca, 2008
neural crest cell migration disrupted, abnormal WT + MO2-sox32 standard conditions Fig. 1 with image from Reichenbach et al., 2008
endocardium morphogenesis disrupted, abnormal WT + MO2-sox32 standard conditions Fig. 10 with image from Wong et al., 2012
pharyngeal arch pdgfaa expression absent, abnormal WT + MO2-sox32 standard conditions Fig. 1 from Mao et al., 2019
determination of left/right symmetry disrupted, abnormal WT + MO2-sox32 standard conditions Fig. 3 with image from Wang et al., 2008
primordial germ cell aggregated, abnormal s870Tg; s903Tg + MO2-sox32 standard conditions Fig. 5 with image from Paksa et al., 2016
pronephric duct anterior region slc4a2a expression amount, ameliorated AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 4 from Tomar et al., 2014
hypoblast has fewer parts of type endodermal cell, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 7 with image from Terashima et al., 2014
endodermal cell differentiation decreased occurrence, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 7 with image from Terashima et al., 2014
pronephric podocyte nphs1 expression absent, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 4 from Tomar et al., 2014
endoderm development disrupted, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 11 with image from Mudumana et al., 2008
pronephric podocyte mislocalised, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 4 from Tomar et al., 2014
pronephric glomerulus morphogenesis disrupted, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 4 from Tomar et al., 2014
pronephric proximal tubule development process quality, ameliorated AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 4 from Tomar et al., 2014
endoderm morphology, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 11 with image from Mudumana et al., 2008
pronephric podocyte nphs2 expression absent, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 4 from Tomar et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.