Morpholino

MO2-lpin1a

ID

ZDB-MRPHLNO-210921-1

Name

MO2-lpin1a

Previous Names

None

Target

lpin1a (1)

Sequence

5' - ATATTCTGTTTGTTCTGACCTGCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-lpin1a

Expressed Gene	Anatomy	Figures
ache	whole organism	Figure 7 from Lu et al., 2021
acta1a	whole organism	Figure 7 from Lu et al., 2021
acta2	whole organism	Figure 7 from Lu et al., 2021
apoea	whole organism	Figure 5 from Lu et al., 2021
axin2	whole organism	Figure 7 from Lu et al., 2021
ccnd1	whole organism	Figure 5 from Lu et al., 2021
chrna1	whole organism	Figure S6 from Lu et al., 2021
chrnb1	whole organism	Figure S6 from Lu et al., 2021
chrnb1l	whole organism	Figure S6 from Lu et al., 2021
chrnd	whole organism	Figure S6 from Lu et al., 2021
chrne	whole organism	Figure S6 from Lu et al., 2021
chrng	whole organism	Figure S6 from Lu et al., 2021
dlc	segmental plate somite whole organism	Figure 7 from Lu et al., 2021
egr1	whole organism	Figure 5 from Lu et al., 2021
egr2a	whole organism	Figure 5 from Lu et al., 2021
egr2b	whole organism	Figure 5 from Lu et al., 2021
isl1a	primary motor neuron whole organism	Figure 7 from Lu et al., 2021
lrp4	hindbrain pectoral fin whole organism	Figure 7 , Figure S9 from Lu et al., 2021
mpz	whole organism	Figure 5 , Figure 7 from Lu et al., 2021
musk	myotome whole organism	Figure 7 , Figure S9 from Lu et al., 2021
mylpfa	whole organism	Figure 7 from Lu et al., 2021
myog	whole organism	Figure 7 from Lu et al., 2021
neurod1	whole organism	Figure 7 from Lu et al., 2021
neurog1	hindbrain midbrain spinal cord whole organism	Figure 7 from Lu et al., 2021
nrg1	whole organism	Figure 7 from Lu et al., 2021
pax2a	whole organism	Figure 7 from Lu et al., 2021
pmp22a	whole organism	Figure 5 from Lu et al., 2021
pou3f1	whole organism	Figure 5 from Lu et al., 2021
ryr1a	whole organism	Figure 7 from Lu et al., 2021

Phenotype

Phenotype resulting from MO2-lpin1a

Phenotype	Fish	Figures
hindbrain neurog1 expression decreased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
hindbrain lrp4 expression decreased amount, abnormal	AB + MO2-lpin1a	Figure S9 from Lu et al., 2021
midbrain neurog1 expression decreased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
motor neuron axon decreased distance motor neuron axon, abnormal	AB + MO2-lpin1a	Figure 4 from Lu et al., 2021
motor neuron axon guidance process quality, abnormal	AB + MO2-lpin1a	Figure 4 from Lu et al., 2021
myelination disrupted, abnormal	ck1Tg + MO2-lpin1a	Figure 5 from Lu et al., 2021
myotome shape, abnormal	AB + MO2-lpin1a	Figure 7 , Figure S9 from Lu et al., 2021
neuromuscular junction development disrupted, abnormal	AB + MO2-lpin1a	Figure 4 from Lu et al., 2021
oligodendrocyte differentiation disrupted, abnormal	ck1Tg + MO2-lpin1a	Figure 5 from Lu et al., 2021
pectoral fin lrp4 expression decreased amount, abnormal	AB + MO2-lpin1a	Figure S9 from Lu et al., 2021
primary motor neuron isl1a expression decreased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
primary motor neuron neuron projection decreased length, abnormal	AB + MO2-lpin1a	Figure 4 from Lu et al., 2021
Schwann cell differentiation disrupted, abnormal	ck1Tg + MO2-lpin1a	Figure 5 from Lu et al., 2021
secondary motor neuron branchiness, abnormal	AB + MO2-lpin1a	Figure 4 from Lu et al., 2021
secondary motor neuron axon decreased length, abnormal	AB + MO2-lpin1a	Figure 4 from Lu et al., 2021
segmental plate dlc expression increased distribution, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
skeletal muscle skeletal muscle myofibril disorganized, abnormal	AB + MO2-lpin1a	Figure 3 from Lu et al., 2021
skeletal muscle acetylcholine-gated channel clustering decreased occurrence, abnormal	AB + MO2-lpin1a	Figure 4 from Lu et al., 2021
somite dlc expression spatial pattern, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
spinal cord neurog1 expression decreased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
swimming decreased linear velocity, abnormal	AB + MO2-lpin1a	Figure 6 from Lu et al., 2021
swimming decreased process quality, abnormal	AB + MO2-lpin1a	Figure 6 from Lu et al., 2021
thigmotaxis decreased occurrence, abnormal	AB + MO2-lpin1a	Figure 6 from Lu et al., 2021
whole organism mpz expression decreased amount, abnormal	ck1Tg + MO2-lpin1a	Figure 5 , Figure 7 from Lu et al., 2021
whole organism pax2a expression decreased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
whole organism acta2 expression decreased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
whole organism axin2 expression decreased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
whole organism chrne expression decreased amount, abnormal	AB + MO2-lpin1a	Figure S6 from Lu et al., 2021
whole organism neurod1 expression decreased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
whole organism chrnb1 expression decreased amount, abnormal	AB + MO2-lpin1a	Figure S6 from Lu et al., 2021
whole organism mylpfa expression decreased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
whole organism egr2a expression decreased amount, abnormal	ck1Tg + MO2-lpin1a	Figure 5 from Lu et al., 2021
whole organism lrp4 expression decreased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
whole organism chrna1 expression decreased amount, abnormal	AB + MO2-lpin1a	Figure S6 from Lu et al., 2021
whole organism ache expression decreased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
whole organism egr2b expression decreased amount, abnormal	ck1Tg + MO2-lpin1a	Figure 5 from Lu et al., 2021
whole organism chrnb1l expression decreased amount, abnormal	AB + MO2-lpin1a	Figure S6 from Lu et al., 2021
whole organism egr1 expression decreased amount, abnormal	ck1Tg + MO2-lpin1a	Figure 5 from Lu et al., 2021
whole organism neurog1 expression decreased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
whole organism myog expression decreased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021
whole organism decreased behavioural activity, abnormal	AB + MO2-lpin1a	Figure 6 from Lu et al., 2021
whole organism pou3f1 expression increased amount, abnormal	ck1Tg + MO2-lpin1a	Figure 5 from Lu et al., 2021
whole organism musk expression increased amount, abnormal	AB + MO2-lpin1a	Figure 7 from Lu et al., 2021

Phenotype of all Fish created by or utilizing MO2-lpin1a

Phenotype	Fish	Conditions	Figures
primary motor neuron isl1a expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
skeletal muscle skeletal muscle myofibril disorganized, abnormal	AB + MO2-lpin1a	standard conditions	Figure 3 from Lu et al., 2021
hindbrain lrp4 expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure S9 from Lu et al., 2021
whole organism chrna1 expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure S6 from Lu et al., 2021
whole organism chrne expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure S6 from Lu et al., 2021
secondary motor neuron branchiness, abnormal	AB + MO2-lpin1a	standard conditions	Figure 4 from Lu et al., 2021
skeletal muscle acetylcholine-gated channel clustering decreased occurrence, abnormal	AB + MO2-lpin1a	standard conditions	Figure 4 from Lu et al., 2021
myotome shape, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 , Figure S9 from Lu et al., 2021
whole organism acta2 expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
motor neuron axon guidance process quality, abnormal	AB + MO2-lpin1a	standard conditions	Figure 4 from Lu et al., 2021
somite dlc expression spatial pattern, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
whole organism neurog1 expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
whole organism myog expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
pectoral fin lrp4 expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure S9 from Lu et al., 2021
hindbrain neurog1 expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
swimming decreased process quality, abnormal	AB + MO2-lpin1a	standard conditions	Figure 6 from Lu et al., 2021
segmental plate dlc expression increased distribution, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
whole organism pax2a expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
whole organism neurod1 expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
whole organism mpz expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
whole organism musk expression increased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
thigmotaxis decreased occurrence, abnormal	AB + MO2-lpin1a	standard conditions	Figure 6 from Lu et al., 2021
whole organism chrnb1l expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure S6 from Lu et al., 2021
secondary motor neuron axon decreased length, abnormal	AB + MO2-lpin1a	standard conditions	Figure 4 from Lu et al., 2021
motor neuron axon decreased distance motor neuron axon, abnormal	AB + MO2-lpin1a	standard conditions	Figure 4 from Lu et al., 2021
neuromuscular junction development disrupted, abnormal	AB + MO2-lpin1a	standard conditions	Figure 4 from Lu et al., 2021
swimming decreased linear velocity, abnormal	AB + MO2-lpin1a	standard conditions	Figure 6 from Lu et al., 2021
primary motor neuron neuron projection decreased length, abnormal	AB + MO2-lpin1a	standard conditions	Figure 4 from Lu et al., 2021
whole organism axin2 expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
midbrain neurog1 expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
whole organism mylpfa expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
spinal cord neurog1 expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
whole organism chrnb1 expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure S6 from Lu et al., 2021
whole organism ache expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
whole organism decreased behavioural activity, abnormal	AB + MO2-lpin1a	standard conditions	Figure 6 from Lu et al., 2021
whole organism lrp4 expression decreased amount, abnormal	AB + MO2-lpin1a	standard conditions	Figure 7 from Lu et al., 2021
whole organism mpz expression decreased amount, abnormal	ck1Tg + MO2-lpin1a	standard conditions	Figure 5 from Lu et al., 2021
whole organism pou3f1 expression increased amount, abnormal	ck1Tg + MO2-lpin1a	standard conditions	Figure 5 from Lu et al., 2021
whole organism egr2a expression decreased amount, abnormal	ck1Tg + MO2-lpin1a	standard conditions	Figure 5 from Lu et al., 2021
Schwann cell differentiation disrupted, abnormal	ck1Tg + MO2-lpin1a	standard conditions	Figure 5 from Lu et al., 2021
myelination disrupted, abnormal	ck1Tg + MO2-lpin1a	standard conditions	Figure 5 from Lu et al., 2021
whole organism egr2b expression decreased amount, abnormal	ck1Tg + MO2-lpin1a	standard conditions	Figure 5 from Lu et al., 2021
whole organism egr1 expression decreased amount, abnormal	ck1Tg + MO2-lpin1a	standard conditions	Figure 5 from Lu et al., 2021
oligodendrocyte differentiation disrupted, abnormal	ck1Tg + MO2-lpin1a	standard conditions	Figure 5 from Lu et al., 2021

Citations