Morpholino

MO3-vgll4l

ID
ZDB-MRPHLNO-200323-1
Name
MO3-vgll4l
Previous Names
None
Target
Sequence
5' - TGTAGTGGAAATTAGTGACCGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-vgll4l
Expressed Gene Anatomy Figures
abcc6a Figure 4 with image from Fillatre et al., 2019
atp6ap1b Figure 4 with image from Fillatre et al., 2019
cdc14aa Figure 4 with image from Fillatre et al., 2019
cfap45 Figure 4 with image from Fillatre et al., 2019
cftr Figure 4 with image from Fillatre et al., 2019
cldn5a Figure 4 with image from Fillatre et al., 2019
daw1 Figure 4 with image from Fillatre et al., 2019
dhrs13a.1 Figure 4 with image from Fillatre et al., 2019
dnaaf4 Figure 4 with image from Fillatre et al., 2019
dnmt3bb.1 Figure 4 with image from Fillatre et al., 2019
dnmt3bb.2 Figure 4 with image from Fillatre et al., 2019
mbd3b Figure 4 with image from Fillatre et al., 2019
ndr1 Figure 4 with image from Fillatre et al., 2019
nme5 Figure 4 with image from Fillatre et al., 2019
odad4 Figure 4 with image from Fillatre et al., 2019
quo Figure 4 with image from Fillatre et al., 2019
rasgef1ba Figure 4 with image from Fillatre et al., 2019
rassf7b Figure 4 with image from Fillatre et al., 2019
si:ch73-364h19.1 Figure 4 with image from Fillatre et al., 2019
slc35d1a Figure 4 with image from Fillatre et al., 2019
sypl2b Figure 4 with image from Fillatre et al., 2019
tekt1 Figure 4 with image from Fillatre et al., 2019
tnfrsf21 Figure 4 with image from Fillatre et al., 2019
vgll4l Figure 4 with image from Fillatre et al., 2019
Phenotype
Phenotype resulting from MO3-vgll4l
Phenotype Fish Figures
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO3-vgll4l Figure 1 with image,  Figure 9 from Fillatre et al., 2019
forerunner cell group dnaaf4 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group dhrs13a.1 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group cfap45 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group si:ch73-364h19.1 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group ndr1 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group cldn5a expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group cftr expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group quo expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group atp6ap1b expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group cdc14aa expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group vgll4l expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group sypl2b expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group tnfrsf21 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group dnmt3bb.2 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group dnmt3bb.1 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group rassf7b expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group odad4 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group mbd3b expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group slc35d1a expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group abcc6a expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group rasgef1ba expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group nme5 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group tekt1 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group daw1 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group DNA-methyltransferase activity decreased occurrence, abnormal s870Tg + MO3-vgll4l Figure 10 from Fillatre et al., 2019
forerunner cell group nucleus ab1-5-mc labeling decreased amount, abnormal s870Tg + MO3-vgll4l Figure 10 from Fillatre et al., 2019
heart jogging process quality, abnormal AB/TU + MO3-vgll4l Figure 1 with image,  Figure 9 from Fillatre et al., 2019
heart tube mislocalised, abnormal AB/TU + MO3-vgll4l Figure 1 with image,  Figure 9 from Fillatre et al., 2019
Phenotype of all Fish created by or utilizing MO3-vgll4l
Phenotype Fish Conditions Figures
forerunner cell group atp6ap1b expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO3-vgll4l standard conditions Figure 1 with image,  Figure 9 from Fillatre et al., 2019
forerunner cell group cldn5a expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group rasgef1ba expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group dnaaf4 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group sypl2b expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group cftr expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group mbd3b expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group daw1 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group vgll4l expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group dnmt3bb.1 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group rassf7b expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group odad4 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group cdc14aa expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group slc35d1a expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group abcc6a expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
heart jogging process quality, abnormal AB/TU + MO3-vgll4l standard conditions Figure 1 with image,  Figure 9 from Fillatre et al., 2019
forerunner cell group dnmt3bb.2 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group cfap45 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group si:ch73-364h19.1 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group quo expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
heart tube mislocalised, abnormal AB/TU + MO3-vgll4l standard conditions Figure 1 with image,  Figure 9 from Fillatre et al., 2019
forerunner cell group tekt1 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group nme5 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group tnfrsf21 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group ndr1 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group dhrs13a.1 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group decreased amount, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 2 with image,  Figure 9 from Fillatre et al., 2019
Kupffer's vesicle decreased size, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 2 with image,  Figure 9 from Fillatre et al., 2019
forerunner cell group apoptotic process increased occurrence, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 2 with image,  Figure 9 from Fillatre et al., 2019
Kupffer's vesicle motile cilium decreased length, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 3 with image,  Figure 9 from Fillatre et al., 2019
forerunner cell group cell population proliferation decreased occurrence, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 9 from Fillatre et al., 2019
forerunner cell group DNA-methyltransferase activity decreased occurrence, abnormal s870Tg + MO3-vgll4l standard conditions Figure 10 from Fillatre et al., 2019
forerunner cell group nucleus ab1-5-mc labeling decreased amount, abnormal s870Tg + MO3-vgll4l standard conditions Figure 10 from Fillatre et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.