Morpholino

MO5-kmt2a

ID

ZDB-MRPHLNO-150624-3

Name

MO5-kmt2a

Previous Names

Target

Sequence

5' - TAGCCCCGAACGAGCGATCTCAGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO, targets the 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-kmt2a

Expressed Gene	Anatomy	Figures
mag	myelinating Schwann cell	Fig. 6 from Huang et al., 2015
neurog1	central nervous system neural plate	Fig. 4 from Huang et al., 2015
olig1	(not) hindbrain oligodendrocyte midbrain oligodendrocyte	Fig. 6 from Huang et al., 2015
slc1a3a	spinal cord neural tube glioblast	Fig. 6 from Huang et al., 2015
sox2	neural plate	Fig. 2 , Fig. 3 from Huang et al., 2015

Phenotype

Phenotype resulting from MO5-kmt2a

Phenotype	Fish	Figures
astrocyte decreased amount, abnormal	mi2001Tg + MO5-kmt2a	Fig. 6 from Huang et al., 2015
brain lacks parts or has fewer parts of type oligodendrocyte, abnormal	WT + MO5-kmt2a	Fig. 6 from Huang et al., 2015
brain malformed, abnormal	WT + MO5-kmt2a	Fig. 1 from Huang et al., 2015
brain morphology, abnormal	WT + MO5-kmt2a	Fig. 1 from Huang et al., 2015
nervous system has fewer parts of type glioblast, abnormal	WT + MO5-kmt2a	Fig. 6 from Huang et al., 2015
neural precursor cell proliferation decreased process quality, abnormal	WT + MO5-kmt2a	Fig. 2 from Huang et al., 2015
peripheral nervous system lacks parts or has fewer parts of type myelinating Schwann cell, abnormal	WT + MO5-kmt2a	Fig. 6 from Huang et al., 2015

Phenotype of all Fish created by or utilizing MO5-kmt2a

Phenotype	Fish	Conditions	Figures
brain morphology, abnormal	WT + MO5-kmt2a	standard conditions	Fig. 1 from Huang et al., 2015
neural precursor cell proliferation decreased process quality, abnormal	WT + MO5-kmt2a	standard conditions	Fig. 2 from Huang et al., 2015
peripheral nervous system lacks parts or has fewer parts of type myelinating Schwann cell, abnormal	WT + MO5-kmt2a	standard conditions	Fig. 6 from Huang et al., 2015
brain malformed, abnormal	WT + MO5-kmt2a	standard conditions	Fig. 1 from Huang et al., 2015
nervous system has fewer parts of type glioblast, abnormal	WT + MO5-kmt2a	standard conditions	Fig. 6 from Huang et al., 2015
brain lacks parts or has fewer parts of type oligodendrocyte, abnormal	WT + MO5-kmt2a	standard conditions	Fig. 6 from Huang et al., 2015
astrocyte decreased amount, abnormal	mi2001Tg + MO5-kmt2a	standard conditions	Fig. 6 from Huang et al., 2015

Citations