Morpholino
MO1-septin15
- ID
- ZDB-MRPHLNO-140606-7
- Name
- MO1-septin15
- Previous Names
-
- MO1-sept15
- TBMO (1)
- Target
- Sequence
-
5' - TCGGGTCTCTCGATCATTGTCCTGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-septin15
Expressed Gene | Anatomy | Figures |
---|---|---|
aldh1a2 |
Fig. 7
from Dash et al., 2017 |
|
ascl1b |
Fig. 6
from Dash et al., 2016 |
|
ins |
Fig. 2 ,
Fig. 3 ,
Fig. 4 ,
Fig. 7 ,
Fig. 8
from Dash et al., 2016 |
|
myl7 |
Fig. 7
from Dash et al., 2014 |
|
notch1a |
Fig. 6
from Dash et al., 2016 |
|
notch1b |
Fig. 6
from Dash et al., 2016 |
|
pck1 |
Fig. 8
from Dash et al., 2016 |
|
pdx1 |
Fig. 5
from Dash et al., 2016 |
|
prss1 |
Fig. 4
from Dash et al., 2016 |
|
septin15 |
|
Fig. 2
from Dash et al., 2017 Fig. 2 from Dash et al., 2014 |
shha |
Fig. 6
from Dash et al., 2016 |
|
spaw |
Fig. 7
from Dash et al., 2014 |
Phenotype
Phenotype resulting from MO1-septin15
Phenotype of all Fish created by or utilizing MO1-septin15
Citations