Morpholino

MO4-sbds

ID
ZDB-MRPHLNO-120820-2
Name
MO4-sbds
Previous Names
  • Sbds ATG MO (1)
Target
Sequence
5' - TTAGTTGGCGTGAATATTGACATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-sbds
Expressed Gene Anatomy Figures
cdkn1a Fig. 3 with image from Provost et al., 2012
mpx Fig. 2 with image,  Fig. 3 with image from Provost et al., 2012
pes Fig. 7 with image from Provost et al., 2012
rpl3 Fig. 5 with image from Provost et al., 2012
tp53 Fig. 3 with image from Provost et al., 2012
Phenotype
Phenotype resulting from MO4-sbds
Phenotype Fish Figures
anterior lateral mesoderm neutrophil absent, abnormal WT + MO4-sbds Fig. 2 with image from Provost et al., 2012
ceratobranchial cartilage morphology, abnormal WT + MO4-sbds Fig. 2 with image from Provost et al., 2012
ceratohyal cartilage morphology, abnormal WT + MO4-sbds Fig. 2 with image from Provost et al., 2012
endocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds Fig. 2 with image,  Fig. 3 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 Fig. 3 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 Fig. 3 with image from Provost et al., 2012
intermediate cell mass of mesoderm neutrophil absent, abnormal WT + MO4-sbds Fig. 2 with image,  Fig. 3 with image from Provost et al., 2012
neutrophil aggregation disrupted, abnormal WT + MO4-sbds Fig. 2 with image from Provost et al., 2012
opercle decreased thickness, abnormal WT + MO4-sbds Fig. 2 with image from Provost et al., 2012
opercle shape, abnormal WT + MO4-sbds Fig. 2 with image from Provost et al., 2012
pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds Fig. 2 with image from Provost et al., 2012
post-vent region curved, abnormal jh1Tg; jh2Tg + MO4-sbds Fig. 3 with image from Provost et al., 2012
whole organism dead, abnormal WT + MO4-sbds Fig. 1 with image from Provost et al., 2012
whole organism cytosolic ribosome assembly disrupted, abnormal WT + MO4-sbds Fig. 1 with image from Provost et al., 2012
whole organism cytosolic small ribosomal subunit decreased amount, abnormal WT + MO4-sbds Fig. 1 with image from Provost et al., 2012
Phenotype of all Fish created by or utilizing MO4-sbds
Phenotype Fish Conditions Figures
intermediate cell mass of mesoderm neutrophil absent, abnormal WT + MO4-sbds standard conditions Fig. 2 with image,  Fig. 3 with image from Provost et al., 2012
whole organism cytosolic ribosome assembly disrupted, abnormal WT + MO4-sbds standard conditions Fig. 1 with image from Provost et al., 2012
whole organism cytosolic small ribosomal subunit decreased amount, abnormal WT + MO4-sbds standard conditions Fig. 1 with image from Provost et al., 2012
opercle shape, abnormal WT + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
opercle decreased thickness, abnormal WT + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
neutrophil aggregation disrupted, abnormal WT + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
whole organism dead, abnormal WT + MO4-sbds standard conditions Fig. 1 with image from Provost et al., 2012
ceratohyal cartilage morphology, abnormal WT + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
anterior lateral mesoderm neutrophil absent, abnormal WT + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
ceratobranchial cartilage morphology, abnormal WT + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
post-vent region curved, abnormal WT + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
intermediate cell mass of mesoderm neutrophil absent, abnormal WT + MO4-sbds + MO4-tp53 standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO3-tp53 + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal jh1Tg; jh2Tg + MO3-tp53 + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
endocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO3-tp53 + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
post-vent region curved, abnormal jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
endocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 2 with image,  Fig. 3 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
endocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal tp53zdf1/zdf1 + MO4-sbds standard conditions Fig. 7 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal tp53zdf1/zdf1 + MO4-sbds standard conditions Fig. 7 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal tp53zdf1/zdf1; jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 5 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal tp53zdf1/zdf1; jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 5 with image from Provost et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.