Morpholino

MO1-foxo3b

ID
ZDB-MRPHLNO-110929-9
Name
MO1-foxo3b
Previous Names
  • foxo3b-ATG-MO (1)
Target
Sequence
5' - TGGCTCCAGGGTTGTCTCTGCCATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-foxo3b
Expressed Gene Anatomy Figures
bmp2b Fig. 6 with image from Xie et al., 2011
bmp4 Fig. 6 with image from Xie et al., 2011
cdx4 Fig. 6 with image from Xie et al., 2011
foxi1 Fig. 6 with image from Xie et al., 2011
gata2a Fig. 6 with image from Xie et al., 2011
gsc Fig. 4 with image from Xie et al., 2011
hmx3a Fig. 3 with image from Xie et al., 2011
ndr1 Fig. 4 with image from Xie et al., 2011
noto Fig. 4 with image from Xie et al., 2011
pax6a Fig. 3 with image from Xie et al., 2011
six3b Fig. 3 with image from Xie et al., 2011
tbx5a Fig. 3 with image from Xie et al., 2011
vhl Fig. 7 from Liu et al., 2016
wnt8a Fig. 6 with image from Xie et al., 2011
Phenotype
Phenotype resulting from MO1-foxo3b
Phenotype Fish Figures
brain malformed, abnormal AB + MO1-foxo3b Fig. 2 with image from Xie et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-foxo3b Fig. 4 with image,  Fig. 6 with image from Xie et al., 2011
eye decreased size, abnormal AB + MO1-foxo3b Fig. 2 with image from Xie et al., 2011
head decreased thickness, abnormal AB + MO1-foxo3b Fig. 2 with image from Xie et al., 2011
heart malformed, abnormal AB + MO1-foxo3b Fig. 2 with image from Xie et al., 2011
neural tube patterning disrupted, abnormal AB + MO1-foxo3b Fig. 3 with image,  Fig. 6 with image from Xie et al., 2011
whole organism vhl expression decreased amount, abnormal AB + MO1-foxo3b Fig. 7 from Liu et al., 2016
whole organism decreased length, abnormal AB + MO1-foxo3b Fig. 2 with image from Xie et al., 2011
Wnt signaling pathway process quality, abnormal AB + MO1-foxo3b Fig. 6 with image from Xie et al., 2011
Phenotype of all Fish created by or utilizing MO1-foxo3b
Phenotype Fish Conditions Figures
head decreased thickness, abnormal AB + MO1-foxo3b standard conditions Fig. 2 with image from Xie et al., 2011
neural tube patterning disrupted, abnormal AB + MO1-foxo3b standard conditions Fig. 3 with image,  Fig. 6 with image from Xie et al., 2011
Wnt signaling pathway process quality, abnormal AB + MO1-foxo3b standard conditions Fig. 6 with image from Xie et al., 2011
heart malformed, abnormal AB + MO1-foxo3b standard conditions Fig. 2 with image from Xie et al., 2011
brain malformed, abnormal AB + MO1-foxo3b standard conditions Fig. 2 with image from Xie et al., 2011
eye decreased size, abnormal AB + MO1-foxo3b standard conditions Fig. 2 with image from Xie et al., 2011
whole organism decreased length, abnormal AB + MO1-foxo3b standard conditions Fig. 2 with image from Xie et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-foxo3b standard conditions Fig. 4 with image,  Fig. 6 with image from Xie et al., 2011
whole organism vhl expression decreased amount, abnormal AB + MO1-foxo3b standard conditions Fig. 7 from Liu et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.