Morpholino

MO2-cdh11

ID
ZDB-MRPHLNO-100511-6
Name
MO2-cdh11
Previous Names
  • cdh11MOB (1)
Target
Sequence
5' - AGGAAGCAGACTCTACCTGATGGGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cdh11
Expressed Gene Anatomy Figures
cdh11 Fig. 1 with image,  Fig. S1 with image from Clendenon et al., 2009
cldna Fig. 7 with image from Clendenon et al., 2009
dlx3b Fig. 7 with image from Clendenon et al., 2009
Phenotype
Phenotype resulting from MO2-cdh11
Phenotype Fish Figures
cell-cell adhesion disrupted, abnormal WT + MO2-cdh11 Fig. 2 with image from Clendenon et al., 2009
cranial nerve II decreased thickness, abnormal WT + MO2-cdh11 Fig. 6 with image from Clendenon et al., 2012
cranial nerve II physical object quality, abnormal WT + MO2-cdh11 Fig. 5 with image from Clendenon et al., 2012
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO2-cdh11 Fig. 1 with image from Clendenon et al., 2009
eye decreased size, abnormal WT + MO2-cdh11 Fig. 1 with image from Clendenon et al., 2012
Fig. 1 with image from Clendenon et al., 2009
eye development disrupted, abnormal WT + MO2-cdh11 Fig. 2 with image from Clendenon et al., 2009
hindbrain morphology, abnormal WT + MO2-cdh11 Fig. 2 with image from Clendenon et al., 2009
hindbrain cell cellular adhesivity hindbrain cell, abnormal WT + MO2-cdh11 Fig. 2 with image from Clendenon et al., 2009
hindbrain development disrupted, abnormal WT + MO2-cdh11 Fig. 2 with image from Clendenon et al., 2009
inner ear decreased size, abnormal WT + MO2-cdh11 Fig. 1 with image from Clendenon et al., 2009
lateral longitudinal fasciculus decreased size, abnormal WT + MO2-cdh11 Fig. 7 with image from Clendenon et al., 2009
lens decreased size, abnormal WT + MO2-cdh11 Fig. 1 with image from Clendenon et al., 2012
lens disorganized, abnormal WT + MO2-cdh11 Fig. 1 with image from Clendenon et al., 2012
lens development in camera-type eye disrupted, abnormal WT + MO2-cdh11 Fig. 1 with image from Clendenon et al., 2012
macula morphology, abnormal WT + MO2-cdh11 Fig. 4 with image from Clendenon et al., 2009
medial longitudinal fasciculus decreased size, abnormal WT + MO2-cdh11 Fig. 7 with image from Clendenon et al., 2009
optic tectum has fewer parts of type retinal ganglion cell neuron projection, abnormal WT + MO2-cdh11 Fig. 6 with image from Clendenon et al., 2012
otic vesicle morphology, abnormal WT + MO2-cdh11 Fig. 5 with image from Clendenon et al., 2009
otolith decreased amount, abnormal WT + MO2-cdh11 Fig. 2 with image from Clendenon et al., 2009
otolith decreased size, abnormal WT + MO2-cdh11 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Clendenon et al., 2009
otolith formation disrupted, abnormal WT + MO2-cdh11 Fig. 3 with image from Clendenon et al., 2009
photoreceptor cell differentiation decreased process quality, abnormal WT + MO2-cdh11 Fig. 5 with image from Clendenon et al., 2012
pigment cell development disrupted, abnormal WT + MO2-cdh11 Fig. 2 with image from Clendenon et al., 2009
post-vent region cystic, abnormal WT + MO2-cdh11 Fig. 2 with image from Clendenon et al., 2009
post-vent region increased curvature, abnormal WT + MO2-cdh11 Fig. 1 with image,  Fig. 2 with image from Clendenon et al., 2009
post-vent region cell cellular adhesivity post-vent region cell, abnormal WT + MO2-cdh11 Fig. 2 with image from Clendenon et al., 2009
retina disorganized, abnormal WT + MO2-cdh11 Fig. 1 with image from Clendenon et al., 2012
retina morphology, abnormal WT + MO2-cdh11 Fig. 1 with image from Clendenon et al., 2012
retina apoptotic process increased occurrence, abnormal WT + MO2-cdh11 Fig. 4 with image from Clendenon et al., 2012
retina development in camera-type eye disrupted, abnormal WT + MO2-cdh11 Fig. 1 with image,  Fig. 5 with image from Clendenon et al., 2012
retina layer formation disrupted, abnormal WT + MO2-cdh11 Fig. 1 with image from Clendenon et al., 2012
retinal ganglion cell neuron projection mislocalised, abnormal WT + MO2-cdh11 Fig. 6 with image from Clendenon et al., 2012
retinal ganglion cell axon guidance process quality, abnormal WT + MO2-cdh11 Fig. 6 with image from Clendenon et al., 2012
retinal ganglion cell layer decreased thickness, abnormal WT + MO2-cdh11 Fig. 5 with image from Clendenon et al., 2012
retinal ganglion cell layer disorganized, abnormal WT + MO2-cdh11 Fig. 5 with image from Clendenon et al., 2012
retinal ganglion cell layer has fewer parts of type retinal ganglion cell, abnormal WT + MO2-cdh11 Fig. 5 with image from Clendenon et al., 2012
retinal inner nuclear layer has fewer parts of type amacrine cell, abnormal WT + MO2-cdh11 Fig. 5 with image from Clendenon et al., 2012
rhombomere 3 shape, abnormal WT + MO2-cdh11 Fig. 7 with image from Clendenon et al., 2009
rhombomere 5 shape, abnormal WT + MO2-cdh11 Fig. 7 with image from Clendenon et al., 2009
whole organism decreased length, abnormal WT + MO2-cdh11 Fig. 2 with image from Clendenon et al., 2009
Phenotype of all Fish created by or utilizing MO2-cdh11
Phenotype Fish Conditions Figures
otolith decreased amount, abnormal WT + MO2-cdh11 standard conditions Fig. 2 with image from Clendenon et al., 2009
retinal ganglion cell neuron projection mislocalised, abnormal WT + MO2-cdh11 standard conditions Fig. 6 with image from Clendenon et al., 2012
retina development in camera-type eye disrupted, abnormal WT + MO2-cdh11 standard conditions Fig. 1 with image,  Fig. 5 with image from Clendenon et al., 2012
macula morphology, abnormal WT + MO2-cdh11 standard conditions Fig. 4 with image from Clendenon et al., 2009
otolith decreased size, abnormal WT + MO2-cdh11 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Clendenon et al., 2009
retina layer formation disrupted, abnormal WT + MO2-cdh11 standard conditions Fig. 1 with image from Clendenon et al., 2012
inner ear decreased size, abnormal WT + MO2-cdh11 standard conditions Fig. 1 with image from Clendenon et al., 2009
post-vent region cell cellular adhesivity post-vent region cell, abnormal WT + MO2-cdh11 standard conditions Fig. 2 with image from Clendenon et al., 2009
retinal ganglion cell layer disorganized, abnormal WT + MO2-cdh11 standard conditions Fig. 5 with image from Clendenon et al., 2012
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO2-cdh11 standard conditions Fig. 1 with image from Clendenon et al., 2009
retinal inner nuclear layer has fewer parts of type amacrine cell, abnormal WT + MO2-cdh11 standard conditions Fig. 5 with image from Clendenon et al., 2012
hindbrain cell cellular adhesivity hindbrain cell, abnormal WT + MO2-cdh11 standard conditions Fig. 2 with image from Clendenon et al., 2009
otic vesicle morphology, abnormal WT + MO2-cdh11 standard conditions Fig. 5 with image from Clendenon et al., 2009
retinal ganglion cell layer has fewer parts of type retinal ganglion cell, abnormal WT + MO2-cdh11 standard conditions Fig. 5 with image from Clendenon et al., 2012
whole organism decreased length, abnormal WT + MO2-cdh11 standard conditions Fig. 2 with image from Clendenon et al., 2009
retinal ganglion cell layer decreased thickness, abnormal WT + MO2-cdh11 standard conditions Fig. 5 with image from Clendenon et al., 2012
eye development disrupted, abnormal WT + MO2-cdh11 standard conditions Fig. 2 with image from Clendenon et al., 2009
pigment cell development disrupted, abnormal WT + MO2-cdh11 standard conditions Fig. 2 with image from Clendenon et al., 2009
cell-cell adhesion disrupted, abnormal WT + MO2-cdh11 standard conditions Fig. 2 with image from Clendenon et al., 2009
rhombomere 3 shape, abnormal WT + MO2-cdh11 standard conditions Fig. 7 with image from Clendenon et al., 2009
medial longitudinal fasciculus decreased size, abnormal WT + MO2-cdh11 standard conditions Fig. 7 with image from Clendenon et al., 2009
optic tectum has fewer parts of type retinal ganglion cell neuron projection, abnormal WT + MO2-cdh11 standard conditions Fig. 6 with image from Clendenon et al., 2012
retinal ganglion cell axon guidance process quality, abnormal WT + MO2-cdh11 standard conditions Fig. 6 with image from Clendenon et al., 2012
lens development in camera-type eye disrupted, abnormal WT + MO2-cdh11 standard conditions Fig. 1 with image from Clendenon et al., 2012
lens decreased size, abnormal WT + MO2-cdh11 standard conditions Fig. 1 with image from Clendenon et al., 2012
rhombomere 5 shape, abnormal WT + MO2-cdh11 standard conditions Fig. 7 with image from Clendenon et al., 2009
eye decreased size, abnormal WT + MO2-cdh11 standard conditions Fig. 1 with image from Clendenon et al., 2012
Fig. 1 with image from Clendenon et al., 2009
photoreceptor cell differentiation decreased process quality, abnormal WT + MO2-cdh11 standard conditions Fig. 5 with image from Clendenon et al., 2012
hindbrain morphology, abnormal WT + MO2-cdh11 standard conditions Fig. 2 with image from Clendenon et al., 2009
retina apoptotic process increased occurrence, abnormal WT + MO2-cdh11 standard conditions Fig. 4 with image from Clendenon et al., 2012
hindbrain development disrupted, abnormal WT + MO2-cdh11 standard conditions Fig. 2 with image from Clendenon et al., 2009
cranial nerve II physical object quality, abnormal WT + MO2-cdh11 standard conditions Fig. 5 with image from Clendenon et al., 2012
retina disorganized, abnormal WT + MO2-cdh11 standard conditions Fig. 1 with image from Clendenon et al., 2012
otolith formation disrupted, abnormal WT + MO2-cdh11 standard conditions Fig. 3 with image from Clendenon et al., 2009
post-vent region cystic, abnormal WT + MO2-cdh11 standard conditions Fig. 2 with image from Clendenon et al., 2009
lateral longitudinal fasciculus decreased size, abnormal WT + MO2-cdh11 standard conditions Fig. 7 with image from Clendenon et al., 2009
post-vent region increased curvature, abnormal WT + MO2-cdh11 standard conditions Fig. 1 with image,  Fig. 2 with image from Clendenon et al., 2009
lens disorganized, abnormal WT + MO2-cdh11 standard conditions Fig. 1 with image from Clendenon et al., 2012
retina morphology, abnormal WT + MO2-cdh11 standard conditions Fig. 1 with image from Clendenon et al., 2012
cranial nerve II decreased thickness, abnormal WT + MO2-cdh11 standard conditions Fig. 6 with image from Clendenon et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.