Morpholino

MO4-sox2

ID
ZDB-MRPHLNO-080329-2
Name
MO4-sox2
Previous Names
  • sox2-MO2 (1)
Target
Sequence
5' - GAGAGGCTGCTGAAGTTACCTTAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-sox2
Expressed Gene Anatomy Figures
gli1 Fig. 5 from Chassaing et al., 2016
ptch1 Fig. 5 from Chassaing et al., 2016
sox2 Fig. 1 from Kamachi et al., 2008
Phenotype
Phenotype resulting from MO4-sox2
Phenotype Fish Figures
eye decreased size, abnormal WT + MO4-sox2 Fig. 3 from Chassaing et al., 2016
somite shape, abnormal WT + MO4-sox2 Fig. S3 from Chassaing et al., 2016
whole organism gli1 expression increased amount, abnormal WT + MO4-sox2 Fig. 5 from Chassaing et al., 2016
whole organism ptch1 expression increased amount, abnormal WT + MO4-sox2 Fig. 5 from Chassaing et al., 2016
Phenotype of all Fish created by or utilizing MO4-sox2
Phenotype Fish Conditions Figures
caudal fin upturned, abnormal WT + MO3-sox2 + MO4-sox2 standard conditions Fig. 1 with image from Okuda et al., 2010
somite shape, abnormal WT + MO4-sox2 standard conditions Fig. S3 from Chassaing et al., 2016
whole organism ptch1 expression increased amount, abnormal WT + MO4-sox2 standard conditions Fig. 5 from Chassaing et al., 2016
whole organism gli1 expression increased amount, abnormal WT + MO4-sox2 standard conditions Fig. 5 from Chassaing et al., 2016
eye decreased size, abnormal WT + MO4-sox2 standard conditions Fig. 3 from Chassaing et al., 2016
central nervous system abnormal, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO4-sox2 standard conditions Fig. 1 with image from Okuda et al., 2010
central nervous system abnormal, abnormal WT + MO1-sox19a + MO2-sox19a + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image from Okuda et al., 2010
central nervous system abnormal, abnormal WT + MO1-sox19b + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image from Okuda et al., 2010
epiboly delayed, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2,  Fig. S8 from Leichsenring et al., 2013
Fig. 1 with image from Okuda et al., 2010
whole organism wholly dorsalized, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 4 with image from Okuda et al., 2010
notochord broad, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
neurogenesis disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
convergent extension disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
mesoderm increased width, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 3 with image from Okuda et al., 2010
axis shortened, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
somite malformed, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2,  Fig. S8 from Leichsenring et al., 2013
tail bud aplastic, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2,  Fig. S8 from Leichsenring et al., 2013
whole organism truncated, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2,  Fig. S8 from Leichsenring et al., 2013
central nervous system abnormal, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image from Okuda et al., 2010
neural plate increased width, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
neural plate development disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 3 with image from Okuda et al., 2010
hindbrain development disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 5 with image from Okuda et al., 2010
central nervous system development disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
brain development disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 5 with image from Okuda et al., 2010
head aplastic, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2,  Fig. S8 from Leichsenring et al., 2013
anterior neural plate formation disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 5 with image from Okuda et al., 2010
prechordal plate increased distance notochord, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
whole organism embryo development arrested, abnormal pou5f3m793/m793 + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2,  Fig. S8 from Leichsenring et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.