Morpholino

MO4-dnmt1

ID
ZDB-MRPHLNO-070615-4
Name
MO4-dnmt1
Previous Names
None
Target
Sequence
5' - ACAATGAGGTCTTGGTAGGCATTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-dnmt1
Expressed Gene Anatomy Figures
ascl1a Fig. 1 with image from Rai et al., 2010
ascl1b Fig. 1 with image from Rai et al., 2010
atoh7 Fig. 3 with image from Rai et al., 2010
cdh1 Fig. 4 from Wang et al., 2017
crx Fig. 3 with image from Rai et al., 2010
dkk1b Fig. 4 from Wang et al., 2017
dusp6 Fig. 4 from Wang et al., 2017
fabp2 Fig. 2 with image from Rai et al., 2010
Fig. 2,  Fig. 7 from Rai et al., 2006
fabp10a Fig. 2 with image from Rai et al., 2010
Fig. 2 from Rai et al., 2006
fgf8a Fig. 4 from Wang et al., 2017
foxa3 Fig. 1 from Rai et al., 2006
foxj1a Fig. 3 from Wang et al., 2017
gata5 Fig. 4 from Wang et al., 2017
gata6 Fig. 2 with image from Rai et al., 2010
Fig. 1 from Rai et al., 2006
hand2 Fig. 2 with image from Rai et al., 2010
hnf1ba Fig. 1 from Rai et al., 2006
id3 Fig. 4 from Wang et al., 2017
ins Fig. 2 with image from Rai et al., 2010
Fig. 6 with image from Anderson et al., 2009
Fig. 2 from Rai et al., 2006
lcp1 Fig. 4 from Deveau et al., 2015
lef1 Fig. 5 with image from Rai et al., 2010
lft2 Fig. 4 from Wang et al., 2017
myb Fig. 4 from Deveau et al., 2015
Fig. 3 with image,  Fig. 5 with image from Liu et al., 2015
neurod1 Fig. 3 with image from Rai et al., 2010
neurog1 Fig. 1 with image from Rai et al., 2010
nkx2.5 Fig. 2 from Wang et al., 2017
opn1sw1 Fig. 2 with image from Rai et al., 2010
opn1sw2 Fig. 2 with image from Rai et al., 2010
otx2b Fig. 3 from Rai et al., 2006
otx5 Fig. 3 from Rai et al., 2006
pax6b Fig. 3 with image from Rai et al., 2010
pcna Fig. 3 with image from Rai et al., 2010
pitx2 Fig. 4 from Wang et al., 2017
prss1 Fig. 2 with image,  Fig. 7 with image from Rai et al., 2010
rbp3 Fig. 2 with image,  Fig. 7 with image from Rai et al., 2010
Fig. 3,  Fig. 7 from Rai et al., 2006
runx1 Fig. 4 from Deveau et al., 2015
sox17 Fig. 3 from Wang et al., 2017
tbxta Fig. 4 from Wang et al., 2017
trp Fig. 2,  Fig. 7 from Rai et al., 2006
Phenotype
Phenotype resulting from MO4-dnmt1
Phenotype Fish Figures
camera-type eye photoreceptor cell differentiation disrupted, abnormal WT + MO4-dnmt1 Fig. 2 with image from Rai et al., 2010
definitive hemopoiesis process quality, abnormal WT + MO4-dnmt1 Fig. 3 with image,  Fig. 5 with image from Liu et al., 2015
determination of heart left/right asymmetry disrupted, abnormal twu34Tg + MO4-dnmt1 Fig. 2 from Wang et al., 2017
determination of heart left/right asymmetry process quality, abnormal twu34Tg + MO4-dnmt1 Fig. 4 from Wang et al., 2017
determination of liver left/right asymmetry disrupted, abnormal dnmt1s872/s872; gz15Tg; m1018Tg + MO4-dnmt1 Fig. EV2 from Wang et al., 2017
determination of pancreatic left/right asymmetry disrupted, abnormal dnmt1s872/s872; gz15Tg; m1018Tg + MO4-dnmt1 Fig. EV2 from Wang et al., 2017
DNA (cytosine-5-)-methyltransferase activity decreased occurrence, abnormal WT + MO4-dnmt1 text only from Rai et al., 2006
DNA (cytosine-5-)-methyltransferase activity increased occurrence, abnormal WT + MO4-dnmt1 Fig. 5 with image from Rai et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO4-dnmt1 Fig. 2 with image from Rai et al., 2010
exocrine pancreas hypoplastic, abnormal gz15Tg + MO4-dnmt1 Fig. 3 with image from Anderson et al., 2009
exocrine pancreas undifferentiated, abnormal WT + MO4-dnmt1 Fig. 2 from Rai et al., 2006
exocrine pancreas development disrupted, abnormal WT + MO4-dnmt1 Fig. 2 from Rai et al., 2006
forerunner cell group decreased amount, abnormal s870Tg + MO4-dnmt1 Fig. 3,  Fig. 4 from Wang et al., 2017
forerunner cell group sox17 expression decreased amount, abnormal WT + MO4-dnmt1 Fig. 3 from Wang et al., 2017
forerunner cell group foxj1a expression decreased amount, abnormal WT + MO4-dnmt1 Fig. 3 from Wang et al., 2017
forerunner cell group lft2 expression increased amount, abnormal s870Tg + MO4-dnmt1 Fig. 4 from Wang et al., 2017
heart jogging disrupted, abnormal twu34Tg + MO4-dnmt1 Fig. 2 from Wang et al., 2017
heart looping process quality, abnormal twu34Tg + MO4-dnmt1 Fig. 2,  Fig. 4 from Wang et al., 2017
heart tube position, abnormal twu34Tg + MO4-dnmt1 Fig. 2 from Wang et al., 2017
hematopoietic stem cell myb expression decreased distribution, abnormal WT + MO4-dnmt1 Fig. 3 with image,  Fig. 5 with image from Liu et al., 2015
hemopoiesis disrupted, abnormal AB + MO4-dnmt1 Fig. 4 from Deveau et al., 2015
hepatocyte mislocalised posteriorly, abnormal gz15Tg + MO4-dnmt1 Fig. 3 with image from Anderson et al., 2009
histone H3K9 monomethyltransferase activity disrupted, abnormal WT + MO4-dnmt1 Fig. 4 from Rai et al., 2006
intestinal epithelium undifferentiated, abnormal WT + MO4-dnmt1 Fig. 2 from Rai et al., 2006
intestinal epithelium gut endothelial cell absent, abnormal WT + MO4-dnmt1 Fig. 1 from Rai et al., 2006
Kupffer's vesicle decreased fluid flow, abnormal s870Tg + MO4-dnmt1 Fig. 3 from Wang et al., 2017
Kupffer's vesicle structure, cavities, abnormal s870Tg + MO4-dnmt1 Fig. 3 from Wang et al., 2017
Kupffer's vesicle cilium decreased amount, abnormal s870Tg + MO4-dnmt1 Fig. 3 from Wang et al., 2017
Kupffer's vesicle cilium decreased length, abnormal s870Tg + MO4-dnmt1 Fig. 3 from Wang et al., 2017
liver hypoplastic, abnormal gz15Tg + MO4-dnmt1 Fig. 3 with image from Anderson et al., 2009
liver position, abnormal dnmt1s872/s872; gz15Tg; m1018Tg + MO4-dnmt1 Fig. EV2 from Wang et al., 2017
mandibular arch skeleton aplastic, abnormal WT + MO4-dnmt1 Fig. 1 from Rai et al., 2006
myeloid cell lcp1 expression decreased amount, abnormal AB + MO4-dnmt1 Fig. 4 from Deveau et al., 2015
pancreas position, abnormal dnmt1s872/s872; gz15Tg; m1018Tg + MO4-dnmt1 Fig. EV2 from Wang et al., 2017
pericardium edematous, abnormal WT + MO4-dnmt1 Fig. 1 from Rai et al., 2006
pharyngeal arch 2 skeleton aplastic, abnormal WT + MO4-dnmt1 Fig. 1 from Rai et al., 2006
post-vent region curved ventral, abnormal WT + MO4-dnmt1 Fig. 1 from Rai et al., 2006
retina disorganized, abnormal WT + MO4-dnmt1 Fig. 3 from Rai et al., 2006
retina development in camera-type eye disrupted, abnormal WT + MO4-dnmt1 Fig. 3 from Rai et al., 2006
retina layer formation disrupted, abnormal WT + MO4-dnmt1 Fig. 3 with image from Rai et al., 2010
retinal pigmented epithelium dorsal region absent, abnormal WT + MO4-dnmt1 Fig. 2 with image from Rai et al., 2010
retinal pigmented epithelium dorsal region aplastic, abnormal WT + MO4-dnmt1 Fig. 3 from Rai et al., 2006
whole organism pitx2 expression decreased amount, abnormal s870Tg + MO4-dnmt1 Fig. 4 from Wang et al., 2017
whole organism gata5 expression decreased amount, abnormal s870Tg + MO4-dnmt1 Fig. 4 from Wang et al., 2017
whole organism tbxta expression decreased amount, abnormal s870Tg + MO4-dnmt1 Fig. 4 from Wang et al., 2017
whole organism id3 expression decreased amount, abnormal s870Tg + MO4-dnmt1 Fig. 4 from Wang et al., 2017
whole organism dkk1b expression decreased amount, abnormal s870Tg + MO4-dnmt1 Fig. 4 from Wang et al., 2017
whole organism cdh1 expression decreased amount, abnormal s870Tg + MO4-dnmt1 Fig. 4 from Wang et al., 2017
whole organism fgf8a expression decreased amount, abnormal s870Tg + MO4-dnmt1 Fig. 4 from Wang et al., 2017
whole organism dusp6 expression decreased amount, abnormal s870Tg + MO4-dnmt1 Fig. 4 from Wang et al., 2017
whole organism lft2 expression increased amount, abnormal s870Tg + MO4-dnmt1 Fig. 4 from Wang et al., 2017
whole organism DNA-methyltransferase activity decreased occurrence, abnormal s870Tg + MO4-dnmt1 Fig. 1 from Wang et al., 2017
Phenotype of all Fish created by or utilizing MO4-dnmt1
Phenotype Fish Conditions Figures
hemopoiesis disrupted, abnormal AB + MO4-dnmt1 standard conditions Fig. 4 from Deveau et al., 2015
myeloid cell lcp1 expression decreased amount, abnormal AB + MO4-dnmt1 standard conditions Fig. 4 from Deveau et al., 2015
pharyngeal arch 2 skeleton aplastic, abnormal WT + MO4-dnmt1 standard conditions Fig. 1 from Rai et al., 2006
histone H3K9 monomethyltransferase activity disrupted, abnormal WT + MO4-dnmt1 standard conditions Fig. 4 from Rai et al., 2006
forerunner cell group foxj1a expression decreased amount, abnormal WT + MO4-dnmt1 standard conditions Fig. 3 from Wang et al., 2017
forerunner cell group sox17 expression decreased amount, abnormal WT + MO4-dnmt1 standard conditions Fig. 3 from Wang et al., 2017
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO4-dnmt1 standard conditions Fig. 2 with image from Rai et al., 2010
exocrine pancreas undifferentiated, abnormal WT + MO4-dnmt1 standard conditions Fig. 2 from Rai et al., 2006
exocrine pancreas development disrupted, abnormal WT + MO4-dnmt1 standard conditions Fig. 2 from Rai et al., 2006
DNA (cytosine-5-)-methyltransferase activity increased occurrence, abnormal WT + MO4-dnmt1 standard conditions Fig. 5 with image from Rai et al., 2010
retinal pigmented epithelium dorsal region aplastic, abnormal WT + MO4-dnmt1 standard conditions Fig. 3 from Rai et al., 2006
post-vent region curved ventral, abnormal WT + MO4-dnmt1 standard conditions Fig. 1 from Rai et al., 2006
retina layer formation disrupted, abnormal WT + MO4-dnmt1 standard conditions Fig. 3 with image from Rai et al., 2010
retina disorganized, abnormal WT + MO4-dnmt1 standard conditions Fig. 3 from Rai et al., 2006
definitive hemopoiesis process quality, abnormal WT + MO4-dnmt1 control Fig. 3 with image,  Fig. 5 with image from Liu et al., 2015
hematopoietic stem cell myb expression decreased distribution, abnormal WT + MO4-dnmt1 control Fig. 3 with image,  Fig. 5 with image from Liu et al., 2015
intestinal epithelium undifferentiated, abnormal WT + MO4-dnmt1 standard conditions Fig. 2 from Rai et al., 2006
retinal pigmented epithelium dorsal region absent, abnormal WT + MO4-dnmt1 standard conditions Fig. 2 with image from Rai et al., 2010
intestinal epithelium gut endothelial cell absent, abnormal WT + MO4-dnmt1 standard conditions Fig. 1 from Rai et al., 2006
mandibular arch skeleton aplastic, abnormal WT + MO4-dnmt1 standard conditions Fig. 1 from Rai et al., 2006
pericardium edematous, abnormal WT + MO4-dnmt1 standard conditions Fig. 1 from Rai et al., 2006
camera-type eye photoreceptor cell differentiation disrupted, abnormal WT + MO4-dnmt1 standard conditions Fig. 2 with image from Rai et al., 2010
retina development in camera-type eye disrupted, abnormal WT + MO4-dnmt1 standard conditions Fig. 3 from Rai et al., 2006
DNA (cytosine-5-)-methyltransferase activity decreased occurrence, abnormal WT + MO4-dnmt1 standard conditions text only from Rai et al., 2006
exocrine pancreas hypoplastic, abnormal gz15Tg + MO4-dnmt1 standard conditions Fig. 3 with image from Anderson et al., 2009
liver hypoplastic, abnormal gz15Tg + MO4-dnmt1 standard conditions Fig. 3 with image from Anderson et al., 2009
hepatocyte mislocalised posteriorly, abnormal gz15Tg + MO4-dnmt1 standard conditions Fig. 3 with image from Anderson et al., 2009
whole organism fgf8a expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
whole organism pitx2 expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
forerunner cell group decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 3,  Fig. 4 from Wang et al., 2017
Kupffer's vesicle cilium decreased length, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 3 from Wang et al., 2017
whole organism id3 expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
Kupffer's vesicle structure, cavities, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 3 from Wang et al., 2017
whole organism gata5 expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
whole organism lft2 expression increased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
Kupffer's vesicle decreased fluid flow, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 3 from Wang et al., 2017
whole organism cdh1 expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
forerunner cell group lft2 expression increased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
whole organism tbxta expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
whole organism dusp6 expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
whole organism DNA-methyltransferase activity decreased occurrence, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 1 from Wang et al., 2017
whole organism dkk1b expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
Kupffer's vesicle cilium decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 3 from Wang et al., 2017
heart looping process quality, abnormal twu34Tg + MO4-dnmt1 standard conditions Fig. 2,  Fig. 4 from Wang et al., 2017
heart tube position, abnormal twu34Tg + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
determination of heart left/right asymmetry process quality, abnormal twu34Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
heart jogging disrupted, abnormal twu34Tg + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
determination of heart left/right asymmetry disrupted, abnormal twu34Tg + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
pancreas position, abnormal dnmt1s872/s872; gz15Tg; m1018Tg + MO4-dnmt1 standard conditions Fig. EV2 from Wang et al., 2017
determination of pancreatic left/right asymmetry disrupted, abnormal dnmt1s872/s872; gz15Tg; m1018Tg + MO4-dnmt1 standard conditions Fig. EV2 from Wang et al., 2017
determination of liver left/right asymmetry disrupted, abnormal dnmt1s872/s872; gz15Tg; m1018Tg + MO4-dnmt1 standard conditions Fig. EV2 from Wang et al., 2017
liver position, abnormal dnmt1s872/s872; gz15Tg; m1018Tg + MO4-dnmt1 standard conditions Fig. EV2 from Wang et al., 2017
whole organism 5-methylcytosine increased amount, abnormal WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
whole organism morphology, ameliorated WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
macromolecule methylation increased occurrence, abnormal WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
whole organism Ab1-h2afva labeling decreased amount, abnormal WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
whole organism decreased life span, abnormal WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
forerunner cell group amount, ameliorated s870Tg + MO4-dnmt1 + MO4-lft2 standard conditions Fig. 4 from Wang et al., 2017
heart looping process quality, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
determination of heart left/right asymmetry disrupted, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
heart tube position, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
heart jogging disrupted, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
heart looping process quality, ameliorated twu34Tg + MO4-dnmt1 + MO4-lft2 standard conditions Fig. 4 from Wang et al., 2017
determination of heart left/right asymmetry process quality, ameliorated twu34Tg + MO4-dnmt1 + MO4-lft2 standard conditions Fig. 4 from Wang et al., 2017
liver decreased size, abnormal uhrf1hi272Tg + MO4-dnmt1 standard conditions Fig. 6 with image from Jacob et al., 2015
head morphology, abnormal uhrf1hi272Tg + MO4-dnmt1 standard conditions Fig. 6 with image from Jacob et al., 2015
caudal hematopoietic tissue EGFP expression decreased distribution, abnormal zf169Tg + MO4-dnmt1 control Fig. 4 with image from Liu et al., 2015
definitive hemopoiesis process quality, abnormal zf169Tg + MO4-dnmt1 control Fig. 4 with image from Liu et al., 2015
dorsal aorta hematopoietic stem cell runx1 expression amount, ameliorated hsi1Tg; zdf13Tg + MO4-dnmt1 heat shock Fig. 4 from Deveau et al., 2015
dorsal aorta hematopoietic stem cell myb expression amount, ameliorated hsi1Tg; zdf13Tg + MO4-dnmt1 heat shock Fig. 4 from Deveau et al., 2015
hemopoiesis process quality, ameliorated hsi1Tg; zdf13Tg + MO4-dnmt1 heat shock Fig. 4 from Deveau et al., 2015
myeloid cell lcp1 expression increased amount, abnormal hsi1Tg; zdf13Tg + MO4-dnmt1 heat shock Fig. 4 from Deveau et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.