Morpholino

MO2-cdx1a

ID
ZDB-MRPHLNO-060602-1
Name
MO2-cdx1a
Previous Names
None
Target
Sequence
5' - CAGCAGATAGCTCACGGACATTTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This sequence differs by one bp from the published cdx1a sequence AB067733, which may be a polymorphism.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cdx1a
Expressed Gene Anatomy Figures
aldh1a2 Fig. 6 with image from Wingert et al., 2007
aqp3a Fig. 5 with image from Wingert et al., 2007
cdh17 Fig. 5 with image,  Fig. 7 with image from Wingert et al., 2007
cdx1a Fig. 1 with image from Davidson et al., 2006
cdx1b Fig. 4 from Flores et al., 2008
cyp26a1 Fig. 6 with image from Wingert et al., 2007
drl Fig. 2 with image from Davidson et al., 2006
egr2b Fig. 6 with image from Wingert et al., 2007
fabp2 Fig. 5 from Flores et al., 2008
gata1a Fig. 4 with image,  Fig. 5 with image from Davidson et al., 2006
gata3 Fig. 5 with image from Wingert et al., 2007
hoxa9a Fig. 2 with image from Davidson et al., 2006
hoxb5a Fig. 2 with image from Davidson et al., 2006
hoxb7a Fig. 2 with image from Davidson et al., 2006
kdrl Fig. 3 with image,  Fig. 5 with image from Davidson et al., 2006
mafba Fig. 5 with image from Wingert et al., 2007
myl7 Fig. 7 with image from Lengerke et al., 2011
myod1 Fig. 6 with image from Wingert et al., 2007
nkx2.5 Fig. 6 with image from Lengerke et al., 2011
pax2a Fig. 5 with image from Lengerke et al., 2011
Fig. 3 with image from Davidson et al., 2006
rag1 Fig. 5 with image from Davidson et al., 2006
runx1 Fig. 5 with image from Davidson et al., 2006
slc12a1 Fig. 5 with image,  Fig. 7 with image from Wingert et al., 2007
slc12a3 Fig. 5 with image,  Fig. 7 with image from Wingert et al., 2007
slc20a1a Fig. 5 with image,  Fig. 7 with image from Wingert et al., 2007
stc1l Fig. 5 with image,  Fig. 7 with image from Wingert et al., 2007
tal1 Fig. 2 with image from Davidson et al., 2006
tbx5a Fig. 5 with image from Lengerke et al., 2011
trpm7 Fig. 5 with image from Wingert et al., 2007
wt1a Fig. 5 with image from Wingert et al., 2007
wt1b Fig. 5 with image,  Fig. 7 with image from Wingert et al., 2007
Phenotype
Phenotype resulting from MO2-cdx1a
No data available
Phenotype of all Fish created by or utilizing MO2-cdx1a
Phenotype Fish Conditions Figures
lateral plate mesoderm tbx5a expression increased distribution, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image from Lengerke et al., 2011
pronephric glomerulus bilateral, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image,  Fig. 7 with image from Wingert et al., 2007
pronephric podocyte unfused from pronephric podocyte, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image,  Fig. 7 with image from Wingert et al., 2007
posterior pronephric duct aplastic, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image from Wingert et al., 2007
corpuscles of Stannius increased size, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Wingert et al., 2007
podocyte aplastic, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Wingert et al., 2007
pronephric glomerulus dilated, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image from Wingert et al., 2007
corpuscles of Stannius aplastic, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image,  Fig. 7 with image from Wingert et al., 2007
pronephric duct opening aplastic, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image from Wingert et al., 2007
pronephric glomerulus cystic, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image from Wingert et al., 2007
intermediate mesoderm pax2a expression mislocalised, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image from Lengerke et al., 2011
pronephric proximal straight tubule aplastic, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image from Wingert et al., 2007
trunk mesenchyme distended, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image from Wingert et al., 2007
pronephric distal early tubule aplastic, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image,  Fig. 7 with image from Wingert et al., 2007
lateral mesoderm myl7 expression amount, ameliorated cdx4tv205c/tv205c + MO2-cdx1a (TU) chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde, chemical treatment by environment: retinoic acid Fig. 7 with image from Lengerke et al., 2011
podocyte mislocalised posteriorly, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image from Wingert et al., 2007
corpuscles of Stannius increased amount, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Wingert et al., 2007
pronephric distal late tubule aplastic, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image,  Fig. 7 with image from Wingert et al., 2007
lateral plate mesoderm nkx2.5 expression increased distribution, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 6 with image from Lengerke et al., 2011
intermediate mesoderm pax2a expression decreased amount, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image from Lengerke et al., 2011
lateral plate mesoderm nkx2.5 expression increased distribution, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) chemical treatment by environment: retinoic acid receptor alpha antagonist Fig. 6 with image from Lengerke et al., 2011
pronephric proximal convoluted tubule decreased length, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Wingert et al., 2007
lateral mesoderm myl7 expression increased amount, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 7 with image from Lengerke et al., 2011
pericardium edematous, abnormal cdx4tv205c/tv205c + MO2-cdx1a (TU) standard conditions Fig. 5 with image from Wingert et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.