Morpholino

MO2-notch1b

ID
ZDB-MRPHLNO-060320-1
Name
MO2-notch1b
Previous Names
  • Notch 1b exon 27 donor (1)
Target
Sequence
5' - AATCTCAAACTGACCTCAAACCGAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-notch1b
Expressed Gene Anatomy Figures
dab2 Fig. S4 from Geudens et al., 2010
efnb2a Fig. 4 with image from Samsa et al., 2015
ephb2a Fig. S4 from Geudens et al., 2010
flt4 Fig. S4 from Geudens et al., 2010
irx3a Fig. 4 with image from Okigawa et al., 2014
mcm5 Fig. 8 with image from Alunni et al., 2013
myh7 Fig. S1 with image from Milan et al., 2006
nkx6.1 Fig. 4 with image from Okigawa et al., 2014
notch1b Fig. 4 with image from Samsa et al., 2015
nrg1 Fig. 4 with image from Samsa et al., 2015
Fig. 7 with image from Milan et al., 2006
tbx20 Fig. S4 from Geudens et al., 2010
Phenotype
Phenotype resulting from MO2-notch1b
Phenotype Fish Figures
angiogenic sprout increased amount, abnormal notch1bzf2046/zf2046; hu4624Tg; nz101Tg + MO2-notch1b Fig. 8 with image from Chiang et al., 2017
blood vessel morphogenesis disrupted, abnormal y1Tg + MO2-notch1b Fig. 3 with image from Leslie et al., 2007
cardiac conduction rate, abnormal WT + MO2-notch1b Fig. 7 with image from Milan et al., 2006
dorsal telencephalon radial glial cell cellular potency, abnormal AB + MO2-notch1b Fig. 8 with image from Alunni et al., 2013
dorsal telencephalon ventricular zone has extra parts of type neuron, abnormal AB + MO2-notch1b Fig. 8 with image from Alunni et al., 2013
heart EGFP expression absent, abnormal um14Tg; vc6Tg + MO2-notch1b Fig. 2 with image from Samsa et al., 2015
heart nrg1 expression decreased amount, abnormal twu26Tg + MO2-notch1b Fig. 4 with image from Samsa et al., 2015
heart efnb2a expression decreased amount, abnormal twu26Tg + MO2-notch1b Fig. 4 with image from Samsa et al., 2015
heart notch1b expression decreased amount, abnormal twu26Tg + MO2-notch1b Fig. 4 with image from Samsa et al., 2015
intersegmental artery decreased amount, abnormal notch1bzf2046/zf2046; hu4624Tg; nz101Tg + MO2-notch1b Fig. 8 with image from Chiang et al., 2017
intersegmental vessel morphology, abnormal y1Tg + MO2-notch1b Fig. 3 with image from Leslie et al., 2007
lymphangiogenesis disrupted, abnormal y1Tg + MO2-notch1b Fig. 1 from Geudens et al., 2010
neuronal stem cell population maintenance decreased occurrence, abnormal AB + MO2-notch1b Fig. 8 with image from Alunni et al., 2013
Notch signaling involved in heart development decreased occurrence, abnormal um14Tg; vc6Tg + MO2-notch1b Fig. 2 with image from Samsa et al., 2015
regulation of blood vessel endothelial cell migration disrupted, abnormal y1Tg + MO2-notch1b Fig. 3 with image from Leslie et al., 2007
sprouting angiogenesis increased process quality, abnormal notch1bzf2046/zf2046; hu4624Tg; nz101Tg + MO2-notch1b Fig. 8 with image from Chiang et al., 2017
thoracic duct absent, abnormal y1Tg + MO2-notch1b Fig. 1 from Geudens et al., 2010
thoracic duct wholeness, abnormal y1Tg + MO2-notch1b Fig. 1 from Geudens et al., 2010
trabecular layer absent, abnormal s843Tg; vc6Tg + MO2-notch1b Fig. 4 with image from Samsa et al., 2015
Phenotype of all Fish created by or utilizing MO2-notch1b
Phenotype Fish Conditions Figures
dorsal telencephalon radial glial cell cellular potency, abnormal AB + MO2-notch1b standard conditions Fig. 8 with image from Alunni et al., 2013
dorsal telencephalon ventricular zone has extra parts of type neuron, abnormal AB + MO2-notch1b standard conditions Fig. 8 with image from Alunni et al., 2013
neuronal stem cell population maintenance decreased occurrence, abnormal AB + MO2-notch1b standard conditions Fig. 8 with image from Alunni et al., 2013
cardiac conduction rate, abnormal WT + MO2-notch1b standard conditions Fig. 7 with image from Milan et al., 2006
heart efnb2a expression decreased amount, abnormal twu26Tg + MO2-notch1b control Fig. 4 with image from Samsa et al., 2015
heart nrg1 expression decreased amount, abnormal twu26Tg + MO2-notch1b control Fig. 4 with image from Samsa et al., 2015
heart notch1b expression decreased amount, abnormal twu26Tg + MO2-notch1b control Fig. 4 with image from Samsa et al., 2015
blood vessel morphogenesis disrupted, abnormal y1Tg + MO2-notch1b standard conditions Fig. 3 with image from Leslie et al., 2007
lymphangiogenesis disrupted, abnormal y1Tg + MO2-notch1b standard conditions Fig. 1 from Geudens et al., 2010
regulation of blood vessel endothelial cell migration disrupted, abnormal y1Tg + MO2-notch1b standard conditions Fig. 3 with image from Leslie et al., 2007
thoracic duct wholeness, abnormal y1Tg + MO2-notch1b standard conditions Fig. 1 from Geudens et al., 2010
thoracic duct absent, abnormal y1Tg + MO2-notch1b standard conditions Fig. 1 from Geudens et al., 2010
intersegmental vessel morphology, abnormal y1Tg + MO2-notch1b standard conditions Fig. 3 with image from Leslie et al., 2007
angiogenic sprout increased amount, abnormal notch1bzf2046/zf2046; hu4624Tg; nz101Tg + MO2-notch1b standard conditions Fig. 8 with image from Chiang et al., 2017
sprouting angiogenesis increased process quality, abnormal notch1bzf2046/zf2046; hu4624Tg; nz101Tg + MO2-notch1b standard conditions Fig. 8 with image from Chiang et al., 2017
intersegmental artery decreased amount, abnormal notch1bzf2046/zf2046; hu4624Tg; nz101Tg + MO2-notch1b standard conditions Fig. 8 with image from Chiang et al., 2017
trabecular layer absent, abnormal s843Tg; vc6Tg + MO2-notch1b control Fig. 4 with image from Samsa et al., 2015
heart EGFP expression absent, abnormal um14Tg; vc6Tg + MO2-notch1b control Fig. 2 with image from Samsa et al., 2015
Notch signaling involved in heart development decreased occurrence, abnormal um14Tg; vc6Tg + MO2-notch1b control Fig. 2 with image from Samsa et al., 2015
CiD increased amount, abnormal nns5Tg + MO2-notch1b + MO3-notch1a + MO4-notch1a standard conditions Fig. 5 with image from Okigawa et al., 2014
VeLD decreased amount, abnormal nns5Tg + MO2-notch1b + MO3-notch1a + MO4-notch1a standard conditions Fig. 5 with image from Okigawa et al., 2014
CiD increased amount, abnormal nns5Tg + MO2-notch1b + MO2-notch3 + MO3-notch1a + MO3-notch3 + MO4-notch1a standard conditions Fig. 5 with image from Okigawa et al., 2014
VeLD decreased amount, abnormal nns5Tg + MO2-notch1b + MO2-notch3 + MO3-notch1a + MO3-notch3 + MO4-notch1a standard conditions Fig. 5 with image from Okigawa et al., 2014
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal s843Tg; uto5Tg + MO1-notch3 + MO2-notch1b control Fig. 3 with image from Chen et al., 2017
dorsal aorta anatomical region mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-notch3 + MO2-notch1b control Fig. 3 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-notch3 + MO2-notch1b control Fig. 3 with image from Chen et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.