Morpholino
MO1-tbxta
- ID
- ZDB-MRPHLNO-050221-3
- Name
- MO1-tbxta
- Previous Names
- Target
- Sequence
-
5' - GACTTGAGGCAGGCATATTTCCGAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Characterized by a normal head, abnormal somites and a reduced tail.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbxta
Expressed Gene | Anatomy | Figures |
---|---|---|
dand5 |
|
Fig. 1 ![]() ![]() ![]() |
enc3 |
Fig. 4 ![]() |
|
fgf3 |
Fig. 4 ![]() |
|
fgf4 |
Fig. 4 ![]() |
|
fgf8a |
Fig. 4 ![]() |
|
lft1 |
Fig. 3
from Amack et al., 2004 |
|
lft2 |
Fig. 3
from Amack et al., 2004 |
|
myf5 |
Fig. 4 ![]() |
|
myod1 |
Fig. 4 ![]() |
|
nphs1 |
Fig. 8 ![]() |
|
nphs2 |
Fig. 8 ![]() |
|
pdia6 |
Fig. 2 ![]() |
|
pitx2 |
Fig. 4
from Burdine et al., 2016 |
|
shha |
Fig. 2 ![]() |
|
slc20a1a |
Fig. 8 ![]() |
|
sox17 |
text only
from Amack et al., 2007 |
|
spaw |
Fig. 4 ![]() Fig. 2 ![]() |
|
tbx16 |
Fig. 6 ![]() |
|
tbxta |
|
Fig. 6 ![]() Fig. 2 ![]() ![]() Fig. 2 from Amack et al., 2004 |
Phenotype
Phenotype resulting from MO1-tbxta
Phenotype of all Fish created by or utilizing MO1-tbxta
Citations