TALEN

TALEN2-nr2f2

ID

ZDB-TALEN-180628-2

Name

TALEN2-nr2f2

Previous Names

None

Target

nr2f2 (1)

Target Sequence 1

5' - TACACATGCCGTGCCAACAG - 3'

Target Sequence 2

5' - TGACACTGATTGCGATGGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
el506	nr2f2

Expression

Gene expression in Wild Types + TALEN2-nr2f2

No data available

Phenotype

Phenotype resulting from TALEN2-nr2f2

No data available

Phenotype of all Fish created by or utilizing TALEN2-nr2f2

Phenotype	Fish	Conditions	Figures
cardiac muscle cell myh7 expression decreased amount, abnormal	nr2f2^el506/+	chemical treatment by environment: retinoic acid	Fig. S5 from Dohn et al., 2019
pectoral protractor ab-mf20 labeling decreased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/+	standard conditions	Fig. S7 from Dohn et al., 2019
heart morphology, abnormal	nr2f1a^el512/el512; nr2f2^el506/+	standard conditions	Fig. 4 from Dohn et al., 2019
presumptive cardiac ventricle primitive heart tube cardiac muscle cell increased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/+	standard conditions	Fig. 5 from Dohn et al., 2019
pectoral protractor absent, abnormal	nr2f1a^el512/el512; nr2f2^el506/+	standard conditions	Fig. S7 from Dohn et al., 2019
pericardium edematous, abnormal	nr2f1a^el512/el512; nr2f2^el506/+	standard conditions	Fig. 3 from Dohn et al., 2019
blood accumulation ball, abnormal	nr2f1a^el512/el512; nr2f2^el506/+	standard conditions	Fig. 3 from Dohn et al., 2019
pectoral protractor decreased size, abnormal	nr2f1a^el512/el512; nr2f2^el506/+	standard conditions	Fig. S7 from Dohn et al., 2019
cardiac ventricle cardiac muscle cell ZsYellow expression increased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/+; fb2Tg; pd42Tg	standard conditions	Fig. 8 from Dohn et al., 2019
cardiac ventricle cardiac muscle cell increased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/+; fb2Tg; pd42Tg	standard conditions	Fig. 8 from Dohn et al., 2019
pectoral protractor ZsYellow expression decreased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/+; fb5Tg; pd42Tg	standard conditions	Fig. 7 from Dohn et al., 2019
pectoral protractor absent, abnormal	nr2f1a^el512/el512; nr2f2^el506/+; fb5Tg; pd42Tg	standard conditions	Fig. 7 from Dohn et al., 2019
cardiac ventricle cardiac muscle cell increased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/+; sd12Tg	standard conditions	Fig. 4 from Dohn et al., 2019
pectoral protractor GFP expression decreased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/+; zf13Tg	standard conditions	Fig. 6 from Dohn et al., 2019
pectoral protractor decreased size, abnormal	nr2f1a^el512/el512; nr2f2^el506/+; zf13Tg	standard conditions	Fig. 6 from Dohn et al., 2019
pectoral protractor absent, abnormal	nr2f1a^el512/el512; nr2f2^el506/+; zf13Tg	standard conditions	Fig. 6 from Dohn et al., 2019
heart morphology, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506	standard conditions	Fig. 4 from Dohn et al., 2019
heart primordium Ab3-nkx2.5 labeling increased distribution, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506	standard conditions	Fig. S4 from Dohn et al., 2019
heart primordium Ab3-nkx2.5 labeling increased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506	standard conditions	Fig. S4 from Dohn et al., 2019
presumptive cardiac ventricle primitive heart tube cardiac muscle cell increased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506	standard conditions	Fig. 5 from Dohn et al., 2019
pectoral protractor absent, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506	standard conditions	Fig. S7 from Dohn et al., 2019
pericardium edematous, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506	standard conditions	Fig. 3 from Dohn et al., 2019
blood accumulation ball, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506	standard conditions	Fig. 3 from Dohn et al., 2019
pectoral protractor decreased size, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506	standard conditions	Fig. S7 from Dohn et al., 2019
pectoral protractor ab-mf20 labeling decreased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506	standard conditions	Fig. S7 from Dohn et al., 2019
cardiac ventricle cardiac muscle cell ZsYellow expression increased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506; fb2Tg; pd42Tg	standard conditions	Fig. 8 from Dohn et al., 2019
pectoral protractor ZsYellow expression decreased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506; fb5Tg; pd42Tg	standard conditions	Fig. 7 from Dohn et al., 2019
pectoral protractor absent, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506; fb5Tg; pd42Tg	standard conditions	Fig. 7 from Dohn et al., 2019
cardiac ventricle cardiac muscle cell increased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506; sd12Tg	standard conditions	Fig. 4 from Dohn et al., 2019
pectoral protractor GFP expression decreased amount, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506; zf13Tg	standard conditions	Fig. 6 from Dohn et al., 2019
pectoral protractor decreased size, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506; zf13Tg	standard conditions	Fig. 6 from Dohn et al., 2019
pectoral protractor absent, abnormal	nr2f1a^el512/el512; nr2f2^el506/el506; zf13Tg	standard conditions	Fig. 6 from Dohn et al., 2019
cranial neural crest cell EGFP expression decreased amount, abnormal	nr2f2^el506/+; nr2f5^el611/el611; el10Tg/el10Tg; y1Tg/y1Tg	standard conditions	Fig. 1 from Okeke et al., 2022
ectomesenchyme grem2b expression decreased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 1 from Okeke et al., 2022
mandibular arch skeleton malformed, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 3 from Okeke et al., 2022
ectomesenchyme dlx2a expression decreased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 1 from Okeke et al., 2022
cranial neural crest cell sox10 expression increased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 2 from Okeke et al., 2022
ectomesenchyme twist1a expression decreased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 1 from Okeke et al., 2022
ectomesenchyme nr2f5 expression decreased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 1 from Okeke et al., 2022
ectomesenchyme sox9a expression decreased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 1 from Okeke et al., 2022
ceratobranchial cartilage absent, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 3 from Okeke et al., 2022
hyomandibula malformed, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 3 from Okeke et al., 2022
ectomesenchyme dlx3b expression decreased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 1 from Okeke et al., 2022
ectomesenchyme fli1 expression decreased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 1 from Okeke et al., 2022
ectomesenchyme prrx1b expression decreased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 1 from Okeke et al., 2022
ectomesenchyme prrx1a expression decreased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 1 from Okeke et al., 2022
ectomesenchyme dlx5a expression decreased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 1 from Okeke et al., 2022
ectomesenchyme ednraa expression decreased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 1 from Okeke et al., 2022
pharyngeal arch 2 dlx6a expression increased distribution, abnormal	nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
maxilla dlx6a expression increased distribution, abnormal	nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
maxilla dlx6a expression increased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 , Fig. 6 from Barske et al., 2018
maxilla dlx5a expression increased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
palatoquadrate arch increased size, abnormal	nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
maxilla dlx5a expression increased distribution, abnormal	nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
mandibular arch skeleton dlx6a expression increased distribution, abnormal	nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
mandibular arch skeleton dlx5a expression increased distribution, abnormal	nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
pharyngeal arch 1 dlx6a expression increased distribution, abnormal	nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch cartilage malformed, abnormal	nr2f2^el506/el506; nr2f5^el611/el611; el2Tg/el2Tg	standard conditions	Fig. 3 from Okeke et al., 2022
cranial neural crest cell EGFP expression decreased amount, abnormal	nr2f2^el506/el506; nr2f5^el611/el611; el10Tg/el10Tg; y1Tg/y1Tg	standard conditions	Fig. 1 from Okeke et al., 2022
mandibular arch skeleton malformed, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 3 from Okeke et al., 2022
ceratobranchial cartilage absent, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 3 from Okeke et al., 2022
hyomandibula malformed, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 3 from Okeke et al., 2022
pterygoid process increased thickness, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
maxilla msx1a expression increased amount, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
maxilla bony projection sox9a expression mislocalised, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
pharyngeal arch 2 ednraa expression decreased amount, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 5 from Barske et al., 2018
palatoquadrate arch increased size, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
maxilla bony projection sox9a expression increased amount, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
maxilla msx1a expression increased distribution, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
maxilla sox9a expression increased distribution, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
pharyngeal arch 2 hand2 expression increased distribution, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
retroarticular increased amount, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
mandibular arch skeleton msx1a expression increased distribution, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
pharyngeal arch 1 ednraa expression decreased amount, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 5 from Barske et al., 2018
pharyngeal arch 1 hand2 expression increased distribution, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 , Fig. 6 from Barske et al., 2018
entopterygoid osteoblast decreased amount, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611; el10Tg (TU)	standard conditions	Fig. 2 from Barske et al., 2018
mandibular arch skeleton dlx3b expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
pterygoid process increased thickness, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
maxilla dlx6a expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
pharyngeal arch 2 dlx5a expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
maxilla dlx6a expression increased amount, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
palatoquadrate arch increased thickness, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
maxilla dlx3b expression increased amount, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
dorsal hyoid arch decreased size, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
maxilla dlx5a expression increased amount, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 , Fig. 6 from Barske et al., 2018
pharyngeal arch 1 dlx5a expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
maxilla dlx5a expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
palatoquadrate arch increased size, exacerbated	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
mandibular arch skeleton dlx6a expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
mandibular arch skeleton dlx5a expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
maxilla nkx3-2 expression increased amount, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
pharyngeal arch 1 nkx3-2 expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
maxilla dlx3b expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
pharyngeal arch 2 hand2 expression spatial pattern, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 1 hand2 expression spatial pattern, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
maxilla dlx5a expression increased amount, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
maxilla dlx6a expression increased amount, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 1 dlx5a expression spatial pattern, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 2 dlx6a expression increased distribution, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 1 dlx6a expression spatial pattern, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
Meckel's cartilage morphology, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
quadrate-anguloarticular joint morphology, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 2 dlx5a expression increased distribution, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 2 jag1b expression increased distribution, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
Meckel's cartilage morphology, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 2 prrx1b expression increased distribution, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 1 prrx1b expression spatial pattern, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 1 jag1b expression spatial pattern, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
quadrate-anguloarticular joint morphology, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
palatoquadrate arch increased size, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
neural crest cell migration decreased occurrence, abnormal	nr2f1a^el512/el512; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018

Citations