Morpholino

MO1-tfg

ID

ZDB-MRPHLNO-240103-1

Name

MO1-tfg

Previous Names

tfg-ATG-MO (1)

Target

tfg (1)

Sequence

5' - CATTCATACTGCTGGTGTTTTGGAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tfg

Expressed Gene	Anatomy	Figures
axin1	whole organism	FIGURE 6 from Chen et al., 2022
axin2	whole organism	FIGURE 6 from Chen et al., 2022
ctnnb1	whole organism	FIGURE 6 from Chen et al., 2022
fzd7a	whole organism	FIGURE 6 from Chen et al., 2022
fzd7b	whole organism	FIGURE 6 from Chen et al., 2022
lef1	whole organism	FIGURE 6 from Chen et al., 2022
lrp5	whole organism	FIGURE 6 from Chen et al., 2022
lrp6	whole organism	FIGURE 6 from Chen et al., 2022
myca	whole organism	FIGURE 6 from Chen et al., 2022
mycn	whole organism	FIGURE 6 from Chen et al., 2022
wnt8a	whole organism	FIGURE 6 from Chen et al., 2022
wnt9a	whole organism	FIGURE 6 from Chen et al., 2022

Phenotype

Phenotype resulting from MO1-tfg

Phenotype	Fish	Figures
brain apoptotic process increased process quality, abnormal	ml2Tg + MO1-tfg	FIGURE 4 from Chen et al., 2022
motor neuron axon GFP expression decreased distribution, abnormal	ml2Tg + MO1-tfg	FIGURE 4 from Chen et al., 2022
motor neuron axon decreased length, abnormal	ml2Tg + MO1-tfg	FIGURE 4 from Chen et al., 2022
post-vent region curved, abnormal	ml2Tg + MO1-tfg	FIGURE 4 from Chen et al., 2022
spinal cord GFP expression decreased distribution, abnormal	ml2Tg + MO1-tfg	FIGURE 4 from Chen et al., 2022
spinal cord apoptotic process increased process quality, abnormal	ml2Tg + MO1-tfg	FIGURE 4 from Chen et al., 2022
swimming behavior decreased process quality, abnormal	ml2Tg + MO1-tfg	FIGURE 5 from Chen et al., 2022
whole organism fzd7b expression increased amount, abnormal	WT + MO1-tfg	FIGURE 6 from Chen et al., 2022
whole organism fzd7a expression increased amount, abnormal	WT + MO1-tfg	FIGURE 6 from Chen et al., 2022
whole organism axin1 expression increased amount, abnormal	WT + MO1-tfg	FIGURE 6 from Chen et al., 2022
whole organism wnt9a expression increased amount, abnormal	WT + MO1-tfg	FIGURE 6 from Chen et al., 2022
whole organism axin2 expression increased amount, abnormal	WT + MO1-tfg	FIGURE 6 from Chen et al., 2022
whole organism lef1 expression increased amount, abnormal	WT + MO1-tfg	FIGURE 6 from Chen et al., 2022
whole organism lrp6 expression increased amount, abnormal	WT + MO1-tfg	FIGURE 6 from Chen et al., 2022
whole organism lrp5 expression increased amount, abnormal	WT + MO1-tfg	FIGURE 6 from Chen et al., 2022
whole organism wnt8a expression increased amount, abnormal	WT + MO1-tfg	FIGURE 6 from Chen et al., 2022
whole organism mycn expression increased amount, abnormal	WT + MO1-tfg	FIGURE 6 from Chen et al., 2022
whole organism myca expression increased amount, abnormal	WT + MO1-tfg	FIGURE 6 from Chen et al., 2022
whole organism ctnnb1 expression increased amount, abnormal	WT + MO1-tfg	FIGURE 6 from Chen et al., 2022
whole organism viability, abnormal	ml2Tg + MO1-tfg	FIGURE 5 from Chen et al., 2022

Phenotype of all Fish created by or utilizing MO1-tfg

Phenotype	Fish	Conditions	Figures
whole organism wnt8a expression increased amount, abnormal	WT + MO1-tfg	control	FIGURE 6 from Chen et al., 2022
whole organism lrp5 expression increased amount, abnormal	WT + MO1-tfg	control	FIGURE 6 from Chen et al., 2022
whole organism myca expression increased amount, abnormal	WT + MO1-tfg	control	FIGURE 6 from Chen et al., 2022
whole organism mycn expression increased amount, abnormal	WT + MO1-tfg	control	FIGURE 6 from Chen et al., 2022
whole organism axin1 expression increased amount, abnormal	WT + MO1-tfg	control	FIGURE 6 from Chen et al., 2022
whole organism lef1 expression increased amount, abnormal	WT + MO1-tfg	control	FIGURE 6 from Chen et al., 2022
whole organism fzd7a expression increased amount, abnormal	WT + MO1-tfg	control	FIGURE 6 from Chen et al., 2022
whole organism ctnnb1 expression increased amount, abnormal	WT + MO1-tfg	control	FIGURE 6 from Chen et al., 2022
whole organism wnt9a expression increased amount, abnormal	WT + MO1-tfg	control	FIGURE 6 from Chen et al., 2022
whole organism lrp6 expression increased amount, abnormal	WT + MO1-tfg	control	FIGURE 6 from Chen et al., 2022
whole organism axin2 expression increased amount, abnormal	WT + MO1-tfg	control	FIGURE 6 from Chen et al., 2022
whole organism fzd7b expression increased amount, abnormal	WT + MO1-tfg	control	FIGURE 6 from Chen et al., 2022
brain apoptotic process increased process quality, abnormal	ml2Tg + MO1-tfg	control	FIGURE 4 from Chen et al., 2022
whole organism viability, abnormal	ml2Tg + MO1-tfg	control	FIGURE 5 from Chen et al., 2022
spinal cord apoptotic process increased process quality, abnormal	ml2Tg + MO1-tfg	control	FIGURE 4 from Chen et al., 2022
swimming behavior decreased process quality, abnormal	ml2Tg + MO1-tfg	control	FIGURE 5 from Chen et al., 2022
motor neuron axon GFP expression decreased distribution, abnormal	ml2Tg + MO1-tfg	control	FIGURE 4 from Chen et al., 2022
spinal cord GFP expression decreased distribution, abnormal	ml2Tg + MO1-tfg	control	FIGURE 4 from Chen et al., 2022
motor neuron axon decreased length, abnormal	ml2Tg + MO1-tfg	control	FIGURE 4 from Chen et al., 2022
post-vent region curved, abnormal	ml2Tg + MO1-tfg	control	FIGURE 4 from Chen et al., 2022

Citations