Morpholino

MO2-rpl10a

ID
ZDB-MRPHLNO-200505-4
Name
MO2-rpl10a
Previous Names
None
Target
Sequence
5' - ATCACAAATATAGACATACCTTCTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rpl10a
Expressed Gene Anatomy Figures
ddx4 Fig. 7,  Figure 8 with image from Palasin et al., 2019
gata1a Fig. 6 from Palasin et al., 2019
nanos1 Fig. 7,  Figure 8 with image from Palasin et al., 2019
tp53 Fig. 6 from Palasin et al., 2019
Phenotype
Phenotype resulting from MO2-rpl10a
Phenotype Fish Figures
extension decreased size, abnormal AB + MO2-rpl10a Figure 3 with image from Palasin et al., 2019
eye decreased pigmentation, abnormal AB + MO2-rpl10a Figure 3 with image from Palasin et al., 2019
eye decreased size, abnormal AB + MO2-rpl10a Figure 3 with image from Palasin et al., 2019
pericardium edematous, abnormal AB + MO2-rpl10a Figure 3 with image from Palasin et al., 2019
post-vent region bent, abnormal AB + MO2-rpl10a Figure 3 with image from Palasin et al., 2019
primordial germ cell nanos1 expression decreased amount, abnormal AB + MO2-rpl10a Figure 8 with image from Palasin et al., 2019
whole organism ddx4 expression decreased amount, abnormal AB + MO2-rpl10a Fig. 7 from Palasin et al., 2019
whole organism nanos1 expression decreased amount, abnormal AB + MO2-rpl10a Fig. 7 from Palasin et al., 2019
whole organism tp53 expression increased amount, abnormal AB + MO2-rpl10a Fig. 6 from Palasin et al., 2019
whole organism hemoglobin decreased amount, abnormal AB + MO2-rpl10a Figure 5 with image from Palasin et al., 2019
Phenotype of all Fish created by or utilizing MO2-rpl10a
Phenotype Fish Conditions Figures
eye decreased pigmentation, abnormal AB + MO2-rpl10a standard conditions Figure 3 with image from Palasin et al., 2019
extension decreased size, abnormal AB + MO2-rpl10a standard conditions Figure 3 with image from Palasin et al., 2019
post-vent region bent, abnormal AB + MO2-rpl10a standard conditions Figure 3 with image from Palasin et al., 2019
eye decreased size, abnormal AB + MO2-rpl10a standard conditions Figure 3 with image from Palasin et al., 2019
pericardium edematous, abnormal AB + MO2-rpl10a standard conditions Figure 3 with image from Palasin et al., 2019
whole organism hemoglobin decreased amount, abnormal AB + MO2-rpl10a standard conditions Figure 5 with image from Palasin et al., 2019
primordial germ cell nanos1 expression decreased amount, abnormal AB + MO2-rpl10a standard conditions Figure 8 with image from Palasin et al., 2019
whole organism ddx4 expression decreased amount, abnormal AB + MO2-rpl10a standard conditions Fig. 7 from Palasin et al., 2019
whole organism tp53 expression increased amount, abnormal AB + MO2-rpl10a standard conditions Fig. 6 from Palasin et al., 2019
whole organism nanos1 expression decreased amount, abnormal AB + MO2-rpl10a standard conditions Fig. 7 from Palasin et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.