Morpholino

MO1-rpl10a

ID
ZDB-MRPHLNO-200505-3
Name
MO1-rpl10a
Previous Names
  • MO AUG (1)
Target
Sequence
5' - GACCTTGCTCATTTTGGCGTGATAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rpl10a
Expressed Gene Anatomy Figures
ddx4 Fig. 7,  Figure 8 with image from Palasin et al., 2019
gata1a Fig. 6 from Palasin et al., 2019
hbae3 Fig. 6 from Palasin et al., 2019
hbbe1.3 Fig. 6 from Palasin et al., 2019
nanos1 Fig. 7,  Figure 8 with image from Palasin et al., 2019
tp53 Fig. 6 from Palasin et al., 2019
Phenotype
Phenotype resulting from MO1-rpl10a
Phenotype Fish Figures
extension decreased size, abnormal AB + MO1-rpl10a Figure 3 with image from Palasin et al., 2019
eye decreased pigmentation, abnormal AB + MO1-rpl10a Figure 3 with image from Palasin et al., 2019
eye decreased size, abnormal AB + MO1-rpl10a Figure 3 with image from Palasin et al., 2019
pericardium edematous, abnormal AB + MO1-rpl10a Figure 3 with image from Palasin et al., 2019
post-vent region bent, abnormal AB + MO1-rpl10a Figure 3 with image from Palasin et al., 2019
primordial germ cell ddx4 expression decreased amount, abnormal AB + MO1-rpl10a Figure 8 with image from Palasin et al., 2019
primordial germ cell nanos1 expression decreased amount, abnormal AB + MO1-rpl10a Figure 8 with image from Palasin et al., 2019
whole organism dead, abnormal AB + MO1-rpl10a text only from Palasin et al., 2019
whole organism gata1a expression decreased amount, abnormal AB + MO1-rpl10a Fig. 6 from Palasin et al., 2019
whole organism hbbe1.3 expression decreased amount, abnormal AB + MO1-rpl10a Fig. 6 from Palasin et al., 2019
whole organism nanos1 expression decreased amount, abnormal AB + MO1-rpl10a Fig. 7 from Palasin et al., 2019
whole organism hbae3 expression decreased amount, abnormal AB + MO1-rpl10a Fig. 6 from Palasin et al., 2019
whole organism ddx4 expression decreased amount, abnormal AB + MO1-rpl10a Fig. 7 from Palasin et al., 2019
whole organism tp53 expression increased amount, abnormal AB + MO1-rpl10a Fig. 6 from Palasin et al., 2019
whole organism hemoglobin decreased amount, abnormal AB + MO1-rpl10a Figure 5 with image from Palasin et al., 2019
Phenotype of all Fish created by or utilizing MO1-rpl10a
Phenotype Fish Conditions Figures
eye decreased pigmentation, abnormal AB + MO1-rpl10a standard conditions Figure 3 with image from Palasin et al., 2019
post-vent region bent, abnormal AB + MO1-rpl10a standard conditions Figure 3 with image from Palasin et al., 2019
whole organism ddx4 expression decreased amount, abnormal AB + MO1-rpl10a standard conditions Fig. 7 from Palasin et al., 2019
whole organism nanos1 expression decreased amount, abnormal AB + MO1-rpl10a standard conditions Fig. 7 from Palasin et al., 2019
primordial germ cell ddx4 expression decreased amount, abnormal AB + MO1-rpl10a standard conditions Figure 8 with image from Palasin et al., 2019
whole organism tp53 expression increased amount, abnormal AB + MO1-rpl10a standard conditions Fig. 6 from Palasin et al., 2019
whole organism gata1a expression decreased amount, abnormal AB + MO1-rpl10a standard conditions Fig. 6 from Palasin et al., 2019
eye decreased size, abnormal AB + MO1-rpl10a standard conditions Figure 3 with image from Palasin et al., 2019
extension decreased size, abnormal AB + MO1-rpl10a standard conditions Figure 3 with image from Palasin et al., 2019
pericardium edematous, abnormal AB + MO1-rpl10a standard conditions Figure 3 with image from Palasin et al., 2019
whole organism hbbe1.3 expression decreased amount, abnormal AB + MO1-rpl10a standard conditions Fig. 6 from Palasin et al., 2019
whole organism hemoglobin decreased amount, abnormal AB + MO1-rpl10a standard conditions Figure 5 with image from Palasin et al., 2019
whole organism dead, abnormal AB + MO1-rpl10a standard conditions text only from Palasin et al., 2019
primordial germ cell nanos1 expression decreased amount, abnormal AB + MO1-rpl10a standard conditions Figure 8 with image from Palasin et al., 2019
whole organism hbae3 expression decreased amount, abnormal AB + MO1-rpl10a standard conditions Fig. 6 from Palasin et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.