Morpholino

MO1-znfl1

ID
ZDB-MRPHLNO-180627-7
Name
MO1-znfl1
Previous Names
  • MO1-znfl1,znfl1b,znfl1c,znfl1g,znfl1h,znfl1i,znfl1j,znfl1k,znfl1l
Targets
Sequence
5' - AATGGTAACACATGGAGGTTCTGTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-znfl1
Expressed Gene Anatomy Figures
cyp26a1 Fig. 2 with image from Li et al., 2018
egr2b Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Li et al., 2018
Fig. 4 from Dong et al., 2017
en2a Fig. 1 with image,  Fig. 2 with image from Li et al., 2018
Fig. 4 from Dong et al., 2017
etv5b Fig. 5 from Li et al., 2018
fgfr1a Fig. 5 from Li et al., 2018
foxj1a Fig. 5 from Li et al., 2018
hoxb1a Fig. 3 from Dong et al., 2017
hoxb1b Fig. 3 from Dong et al., 2017
hoxb4a Fig. 2 with image from Li et al., 2018
hoxd4a Fig. 3,  Fig. 4 from Dong et al., 2017
lft1 Fig. 2 from Li et al., 2018
lft2 Fig. 2 from Li et al., 2018
mafba Fig. 1 with image from Li et al., 2018
myod1 Fig. 1 with image,  Fig. 3 with image from Li et al., 2018
otx2b Fig. 3 from Dong et al., 2017
pitx2 Fig. 2 from Li et al., 2018
pou5f3 Fig. 5,  Fig. 6,  Fig. 7 from Dong et al., 2017
sall4 Fig. 6 from Dong et al., 2017
spaw Fig. 2 from Li et al., 2018
suclg2 Fig. 1 from Li et al., 2018
Phenotype
Phenotype resulting from MO1-znfl1
No data available
Phenotype of all Fish created by or utilizing MO1-znfl1
Phenotype Fish Conditions Figures
heart primordium lft2 expression absent, abnormal WT + MO1-znfl1 standard conditions Fig. 2 from Li et al., 2018
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-znfl1 standard conditions Fig. 4 from Li et al., 2018
forebrain decreased length, abnormal WT + MO1-znfl1 standard conditions Fig. 4 from Dong et al., 2017
determination of left/right symmetry disrupted, abnormal WT + MO1-znfl1 standard conditions Fig. 2,  Fig. 3 from Li et al., 2018
lateral plate mesoderm left side spaw expression absent, abnormal WT + MO1-znfl1 standard conditions Fig. 2 from Li et al., 2018
hindbrain hoxb4a expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 2 with image from Li et al., 2018
presumptive rhombomere 8 hoxd4a expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 3 from Dong et al., 2017
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-znfl1 standard conditions Fig. 1 from Li et al., 2018
neuroectoderm otx2b expression increased distribution, abnormal WT + MO1-znfl1 standard conditions Fig. 3 from Dong et al., 2017
hindbrain decreased length, abnormal WT + MO1-znfl1 standard conditions Fig. 4 from Dong et al., 2017
whole organism sall4 expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 6 from Dong et al., 2017
rhombomere 6 distance somite 1, ameliorated WT + MO1-znfl1 chemical treatment by environment: all-trans-retinoic acid Fig. 3 with image from Li et al., 2018
notochord hoxb1b expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 3 from Dong et al., 2017
rhombomere 6 decreased distance somite 1, abnormal WT + MO1-znfl1 standard conditions Fig. 1 with image,  Fig. 3 with image from Li et al., 2018
heart looping disrupted, abnormal WT + MO1-znfl1 standard conditions Fig. 1 from Li et al., 2018
embryonic structure etv5b expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 5 from Li et al., 2018
rhombomere 7 decreased distance somite 1, abnormal WT + MO1-znfl1 standard conditions Fig. 1 with image from Li et al., 2018
notochord hoxb1a expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 3 from Dong et al., 2017
diencephalon left side lft1 expression absent, abnormal WT + MO1-znfl1 standard conditions Fig. 2 from Li et al., 2018
whole organism pou5f3 expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 5,  Fig. 6,  Fig. 7 from Dong et al., 2017
neuroectoderm otx2b expression increased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 3 from Dong et al., 2017
lateral plate mesoderm left side pitx2 expression absent, abnormal WT + MO1-znfl1 standard conditions Fig. 2 from Li et al., 2018
neuroectoderm cyp26a1 expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 2 with image from Li et al., 2018
presumptive rhombomere 7 hoxd4a expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 3 from Dong et al., 2017
embryonic structure foxj1a expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 5 from Li et al., 2018
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 4 from Li et al., 2018
determination of digestive tract left/right asymmetry disrupted, abnormal WT + MO1-znfl1 standard conditions Fig. 1 from Li et al., 2018
determination of liver left/right asymmetry disrupted, abnormal WT + MO1-znfl1 standard conditions Fig. 1 from Li et al., 2018
mesoderm cyp26a1 expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 2 with image from Li et al., 2018
presumptive rhombomere 4 hoxb1a expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 3 from Dong et al., 2017
presumptive rhombomere 4 hoxb1b expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 3 from Dong et al., 2017
embryonic structure fgfr1a expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 5 from Li et al., 2018
hindbrain neural plate hoxd4a expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 3 from Dong et al., 2017
neuroectoderm hoxb1b expression decreased amount, abnormal WT + MO1-znfl1 standard conditions Fig. 3 from Dong et al., 2017
liver suclg2 expression mislocalised, abnormal WT + MO1-znfl1 standard conditions Fig. 1 from Li et al., 2018
rhombomere 6 distance somite 1, ameliorated WT + MO1-cyp26a1 + MO1-znfl1 standard conditions Fig. 3 with image from Li et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.