Morpholino

MO5-insm1a

ID
ZDB-MRPHLNO-171018-2
Name
MO5-insm1a
Previous Names
None
Target
Sequence
5' - AAATCCTCTGGGCATCTTCGCCAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-insm1a
Phenotype
Phenotype resulting from MO5-insm1a
Phenotype Fish Figures
CaP motoneuron decreased amount, abnormal ml2Tg + MO5-insm1a Fig. S4 with image from Gong et al., 2017
CaP motoneuron distance CaP motoneuron, abnormal ml2Tg + MO5-insm1a Fig. S4 with image from Gong et al., 2017
CaP motoneuron axon decreased length, abnormal ml2Tg + MO5-insm1a Fig. 5 with imageFig. S4 with image from Gong et al., 2017
CaP motoneuron axon increased branchiness, abnormal ml2Tg + MO5-insm1a Fig. 5 with imageFig. S4 with image from Gong et al., 2017
MiP motor neuron decreased amount, abnormal ml2Tg + MO5-insm1a Fig. S4 with image from Gong et al., 2017
myoseptum cxcl12a expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 5 with image from He et al., 2017
neuromast spatial pattern, abnormal zf106Tg + MO4-tp53 + MO5-insm1a Fig. 2 with image from He et al., 2017
neuromast hair cell decreased amount, abnormal s356tTg + MO4-tp53 + MO5-insm1a Fig. 3 with image from He et al., 2017
neuromast hair cell development disrupted, abnormal s356tTg + MO4-tp53 + MO5-insm1a Fig. 3 with image from He et al., 2017
neuron undifferentiated, abnormal ml2Tg + MO5-insm1a Fig. 3 with image from Gong et al., 2017
neuron differentiation decreased process quality, abnormal ml2Tg + MO5-insm1a Fig. 3 with image from Gong et al., 2017
posterior lateral line neuromast hair cell morphogenesis disrupted, abnormal zf106Tg + MO4-tp53 + MO5-insm1a Fig. 2 with image from He et al., 2017
posterior lateral line primordium ackr3b expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 5 with image from He et al., 2017
posterior lateral line primordium etv4 expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 6 with image from He et al., 2017
posterior lateral line primordium decreased size, abnormal s356tTg + MO4-tp53 + MO5-insm1a Fig. 4 with image from He et al., 2017
posterior lateral line primordium cxcr4b expression increased amount, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 5 with image from He et al., 2017
posterior lateral line primordium lef1 expression increased distribution, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 6 with image from He et al., 2017
posterior lateral line primordium axin2 expression increased distribution, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 6 with image from He et al., 2017
posterior lateral line primordium morphology, abnormal s356tTg + MO4-tp53 + MO5-insm1a Fig. 4 with image from He et al., 2017
posterior lateral line primordium cell population proliferation disrupted, abnormal s356tTg + MO4-tp53 + MO5-insm1a Fig. 4 with image from He et al., 2017
posterior lateral line primordium neuromast decreased amount, abnormal zf106Tg + MO4-tp53 + MO5-insm1a Fig. 2 with imageFig. S2 with image from He et al., 2017
regulation of canonical Wnt signaling pathway disrupted, abnormal WT + MO4-tp53 + MO5-insm1a Fig. 6 with image from He et al., 2017
whole organism ascl1b expression decreased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism ascl1a expression decreased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism nkx6.1 expression decreased amount, abnormal AB + MO5-insm1a Fig. 5 with image from Gong et al., 2017
whole organism isl2a expression decreased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism mnx2a expression decreased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism mnx2b expression decreased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism olig2 expression decreased amount, abnormal AB + MO5-insm1a Fig. 5 with image from Gong et al., 2017
whole organism isl2a expression increased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism ascl1a expression increased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism mnx2a expression increased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
whole organism shha expression increased amount, abnormal AB + MO5-insm1a Fig. S5 from Gong et al., 2017
Phenotype of all Fish created by or utilizing MO5-insm1a
Phenotype Fish Conditions Figures
whole organism mnx2b expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism ascl1a expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism ascl1b expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism ascl1a expression increased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism nkx6.1 expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. 5 with image from Gong et al., 2017
whole organism shha expression increased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism olig2 expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. 5 with image from Gong et al., 2017
whole organism mnx2a expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism isl2a expression decreased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism mnx2a expression increased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
whole organism isl2a expression increased amount, abnormal AB + MO5-insm1a standard conditions Fig. S5 from Gong et al., 2017
CaP motoneuron axon decreased length, abnormal AB + MO5-insm1a standard conditions Fig. 5 with image from Gong et al., 2017
CaP motoneuron axon increased branchiness, abnormal AB + MO5-insm1a standard conditions Fig. 5 with image from Gong et al., 2017
posterior lateral line primordium cxcr4b expression increased amount, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 5 with image from He et al., 2017
myoseptum cxcl12a expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 5 with image from He et al., 2017
posterior lateral line primordium lef1 expression increased distribution, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 6 with image from He et al., 2017
posterior lateral line primordium axin2 expression increased distribution, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 6 with image from He et al., 2017
posterior lateral line primordium etv4 expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 6 with image from He et al., 2017
posterior lateral line primordium ackr3b expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 5 with image from He et al., 2017
regulation of canonical Wnt signaling pathway disrupted, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 6 with image from He et al., 2017
MiP motor neuron decreased amount, abnormal ml2Tg + MO5-insm1a standard conditions Fig. S4 with image from Gong et al., 2017
CaP motoneuron decreased amount, abnormal ml2Tg + MO5-insm1a standard conditions Fig. S4 with image from Gong et al., 2017
neuron undifferentiated, abnormal ml2Tg + MO5-insm1a standard conditions Fig. 3 with image from Gong et al., 2017
CaP motoneuron distance CaP motoneuron, abnormal ml2Tg + MO5-insm1a standard conditions Fig. S4 with image from Gong et al., 2017
neuron differentiation decreased process quality, abnormal ml2Tg + MO5-insm1a standard conditions Fig. 3 with image from Gong et al., 2017
CaP motoneuron axon increased branchiness, abnormal ml2Tg + MO5-insm1a standard conditions Fig. S4 with image from Gong et al., 2017
CaP motoneuron axon decreased length, abnormal ml2Tg + MO5-insm1a standard conditions Fig. S4 with image from Gong et al., 2017
posterior lateral line primordium cell population proliferation disrupted, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 4 with image from He et al., 2017
neuromast hair cell decreased amount, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 3 with image from He et al., 2017
posterior lateral line primordium morphology, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 4 with image from He et al., 2017
posterior lateral line primordium decreased size, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 4 with image from He et al., 2017
neuromast hair cell development disrupted, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 3 with image from He et al., 2017
neuromast spatial pattern, abnormal zf106Tg + MO4-tp53 + MO5-insm1a standard conditions Fig. 2 with image from He et al., 2017
posterior lateral line primordium neuromast decreased amount, abnormal zf106Tg + MO4-tp53 + MO5-insm1a standard conditions Fig. 2 with imageFig. S2 with image from He et al., 2017
posterior lateral line neuromast hair cell morphogenesis disrupted, abnormal zf106Tg + MO4-tp53 + MO5-insm1a standard conditions Fig. 2 with image from He et al., 2017
Citations