Morpholino

MO2-uxt

ID
ZDB-MRPHLNO-150508-2
Name
MO2-uxt
Previous Names
None
Target
Sequence
5' - ATAACAGATGTGCCAGAAGTCATGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-uxt
Phenotype
Phenotype resulting from MO2-uxt
Phenotype Fish Figures
caudal fin curled, abnormal AB + MO2-uxt Fig. 1 with image from Zhou et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development decreased occurrence, abnormal s843Tg + MO2-uxt Fig. 7 with image from Zhou et al., 2015
endothelial tip cell blood vessel endothelial cell migration decreased rate, abnormal y7Tg + MO2-uxt Fig. 4 with image from Zhou et al., 2015
hindbrain atrophied, abnormal AB + MO2-uxt Fig. 1 with image from Zhou et al., 2015
intersegmental vessel decreased length, abnormal s843Tg + MO2-uxt Fig. 3 with imageFig. 4 with imageFig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis decreased process quality, abnormal y7Tg + MO2-uxt Fig. 3 with imageFig. 4 with imageFig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis delayed, abnormal y7Tg + MO2-uxt Fig. 4 with image from Zhou et al., 2015
intersegmental vessel angiogenesis process quality, abnormal s843Tg + MO2-uxt Fig. 3 with imageFig. 4 with image from Zhou et al., 2015
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal y7Tg + MO2-uxt Fig. 4 with image from Zhou et al., 2015
Notch signaling pathway increased occurrence, abnormal jh11Tg; y1Tg + MO2-uxt Fig. 6 with image from Zhou et al., 2015
trunk mCherry expression increased amount, abnormal jh11Tg; y1Tg + MO2-uxt Fig. 6 with image from Zhou et al., 2015
trunk shortened, abnormal AB + MO2-uxt Fig. 1 with image from Zhou et al., 2015
trunk vasculature kdrl expression decreased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
trunk vasculature artery efnb2a expression increased amount, abnormal AB + MO2-uxt Fig. 3 with image from Zhou et al., 2015
trunk vasculature artery hey2 expression increased amount, abnormal AB + MO2-uxt Fig. 3 with image from Zhou et al., 2015
trunk vasculature artery notch1b expression increased amount, abnormal AB + MO2-uxt Fig. 3 with image from Zhou et al., 2015
whole organism kdrl expression decreased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
whole organism notch1b expression decreased amount, abnormal AB + MO2-uxt Fig. 5 from Zhou et al., 2015
whole organism vegfaa expression decreased amount, abnormal AB + MO2-uxt Fig. 5 from Zhou et al., 2015
whole organism nes expression decreased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
whole organism flt1 expression decreased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
whole organism ptgs2a expression decreased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
whole organism angpt1 expression decreased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
whole organism decreased pigmentation, abnormal AB + MO2-uxt Fig. 1 with image from Zhou et al., 2015
whole organism dll4 expression increased amount, abnormal AB + MO2-uxt Fig. 5 from Zhou et al., 2015
whole organism her6 expression increased amount, abnormal AB + MO2-uxt Fig. 5 from Zhou et al., 2015
whole organism myod1 expression increased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
whole organism hey1 expression increased amount, abnormal AB + MO2-uxt Fig. 5 from Zhou et al., 2015
Phenotype of all Fish created by or utilizing MO2-uxt
Phenotype Fish Conditions Figures
trunk vasculature artery notch1b expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 3 with image from Zhou et al., 2015
whole organism angpt1 expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
whole organism notch1b expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 5 from Zhou et al., 2015
whole organism vegfaa expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 5 from Zhou et al., 2015
whole organism decreased pigmentation, abnormal AB + MO2-uxt standard conditions Fig. 1 with image from Zhou et al., 2015
trunk vasculature artery hey2 expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 3 with image from Zhou et al., 2015
whole organism nes expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
trunk vasculature kdrl expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
trunk shortened, abnormal AB + MO2-uxt standard conditions Fig. 1 with image from Zhou et al., 2015
hindbrain atrophied, abnormal AB + MO2-uxt standard conditions Fig. 1 with image from Zhou et al., 2015
trunk vasculature artery efnb2a expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 3 with image from Zhou et al., 2015
whole organism ptgs2a expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
caudal fin curled, abnormal AB + MO2-uxt standard conditions Fig. 1 with image from Zhou et al., 2015
whole organism myod1 expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
whole organism her6 expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 5 from Zhou et al., 2015
whole organism hey1 expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 5 from Zhou et al., 2015
whole organism dll4 expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 5 from Zhou et al., 2015
whole organism flt1 expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
whole organism kdrl expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development decreased occurrence, abnormal s843Tg + MO2-uxt control Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis decreased process quality, abnormal s843Tg + MO2-uxt standard conditions Fig. 3 with imageFig. 7 with image from Zhou et al., 2015
intersegmental vessel decreased length, abnormal s843Tg + MO2-uxt standard conditions Fig. 3 with imageFig. 7 with image from Zhou et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development occurrence, ameliorated s843Tg + MO2-uxt chemical treatment by environment: DAPT Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis process quality, abnormal s843Tg + MO2-uxt standard conditions Fig. 3 with image from Zhou et al., 2015
intersegmental vessel angiogenesis process quality, ameliorated s843Tg + MO2-uxt chemical treatment by environment: DAPT Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis delayed, abnormal y7Tg + MO2-uxt standard conditions Fig. 4 with image from Zhou et al., 2015
intersegmental vessel angiogenesis decreased process quality, abnormal y7Tg + MO2-uxt standard conditions Fig. 4 with image from Zhou et al., 2015
intersegmental vessel decreased length, abnormal y7Tg + MO2-uxt standard conditions Fig. 4 with image from Zhou et al., 2015
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal y7Tg + MO2-uxt standard conditions Fig. 4 with image from Zhou et al., 2015
intersegmental vessel angiogenesis process quality, abnormal y7Tg + MO2-uxt standard conditions Fig. 4 with image from Zhou et al., 2015
endothelial tip cell blood vessel endothelial cell migration decreased rate, abnormal y7Tg + MO2-uxt standard conditions Fig. 4 with image from Zhou et al., 2015
Notch signaling pathway increased occurrence, abnormal jh11Tg; y1Tg + MO2-uxt control Fig. 6 with image from Zhou et al., 2015
trunk mCherry expression increased amount, abnormal jh11Tg; y1Tg + MO2-uxt control Fig. 6 with image from Zhou et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development occurrence, ameliorated s843Tg + MO2-uxt + MO4-rbpja,rbpjb standard conditions Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis process quality, ameliorated s843Tg + MO2-uxt + MO4-rbpja,rbpjb standard conditions Fig. 7 with image from Zhou et al., 2015
Citations