Morpholino

MO2-uxt

ID
ZDB-MRPHLNO-150508-2
Name
MO2-uxt
Previous Names
None
Target
Sequence
5' - ATAACAGATGTGCCAGAAGTCATGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-uxt
Expressed Gene Anatomy Figures
angpt1 Fig. 2 with image from Zhou et al., 2015
aplnra Fig. 3 with image from Zhou et al., 2015
dll4 Fig. 5 from Zhou et al., 2015
efnb2a Fig. 3 with image from Zhou et al., 2015
flt1 Fig. 2 with image from Zhou et al., 2015
flt4 Fig. 3 with image from Zhou et al., 2015
her6 Fig. 5 from Zhou et al., 2015
hey1 Fig. 5 from Zhou et al., 2015
hey2 Fig. 3 with image from Zhou et al., 2015
kdrl Fig. 2 with image from Zhou et al., 2015
myod1 Fig. 2 with image from Zhou et al., 2015
nes Fig. 2 with image from Zhou et al., 2015
notch1b Fig. 3 with image,  Fig. 5 from Zhou et al., 2015
notch3 Fig. 3 with image from Zhou et al., 2015
pax2a Fig. 2 with image from Zhou et al., 2015
ptgs2a Fig. 2 with image from Zhou et al., 2015
tbx20 Fig. 3 with image from Zhou et al., 2015
vegfaa Fig. 5 from Zhou et al., 2015
Phenotype
Phenotype resulting from MO2-uxt
Phenotype Fish Figures
caudal fin curled, abnormal AB + MO2-uxt Fig. 1 with image from Zhou et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development decreased occurrence, abnormal s843Tg + MO2-uxt Fig. 7 with image from Zhou et al., 2015
endothelial tip cell blood vessel endothelial cell migration decreased rate, abnormal y7Tg + MO2-uxt Fig. 4 with image from Zhou et al., 2015
hindbrain atrophied, abnormal AB + MO2-uxt Fig. 1 with image from Zhou et al., 2015
intersegmental vessel decreased length, abnormal s843Tg + MO2-uxt Fig. 3 with image,  Fig. 4 with image,  Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis decreased process quality, abnormal s843Tg + MO2-uxt Fig. 3 with image,  Fig. 4 with image,  Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis delayed, abnormal y7Tg + MO2-uxt Fig. 4 with image from Zhou et al., 2015
intersegmental vessel angiogenesis process quality, abnormal y7Tg + MO2-uxt Fig. 3 with image,  Fig. 4 with image from Zhou et al., 2015
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal y7Tg + MO2-uxt Fig. 4 with image from Zhou et al., 2015
Notch signaling pathway increased occurrence, abnormal jh11Tg; y1Tg + MO2-uxt Fig. 6 with image from Zhou et al., 2015
trunk mCherry expression increased amount, abnormal jh11Tg; y1Tg + MO2-uxt Fig. 6 with image from Zhou et al., 2015
trunk shortened, abnormal AB + MO2-uxt Fig. 1 with image from Zhou et al., 2015
trunk vasculature kdrl expression decreased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
trunk vasculature artery efnb2a expression increased amount, abnormal AB + MO2-uxt Fig. 3 with image from Zhou et al., 2015
trunk vasculature artery hey2 expression increased amount, abnormal AB + MO2-uxt Fig. 3 with image from Zhou et al., 2015
trunk vasculature artery notch1b expression increased amount, abnormal AB + MO2-uxt Fig. 3 with image from Zhou et al., 2015
whole organism kdrl expression decreased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
whole organism notch1b expression decreased amount, abnormal AB + MO2-uxt Fig. 5 from Zhou et al., 2015
whole organism vegfaa expression decreased amount, abnormal AB + MO2-uxt Fig. 5 from Zhou et al., 2015
whole organism nes expression decreased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
whole organism flt1 expression decreased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
whole organism ptgs2a expression decreased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
whole organism angpt1 expression decreased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
whole organism decreased pigmentation, abnormal AB + MO2-uxt Fig. 1 with image from Zhou et al., 2015
whole organism dll4 expression increased amount, abnormal AB + MO2-uxt Fig. 5 from Zhou et al., 2015
whole organism her6 expression increased amount, abnormal AB + MO2-uxt Fig. 5 from Zhou et al., 2015
whole organism myod1 expression increased amount, abnormal AB + MO2-uxt Fig. 2 with image from Zhou et al., 2015
whole organism hey1 expression increased amount, abnormal AB + MO2-uxt Fig. 5 from Zhou et al., 2015
Phenotype of all Fish created by or utilizing MO2-uxt
Phenotype Fish Conditions Figures
trunk vasculature artery notch1b expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 3 with image from Zhou et al., 2015
whole organism angpt1 expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
whole organism notch1b expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 5 from Zhou et al., 2015
whole organism vegfaa expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 5 from Zhou et al., 2015
whole organism decreased pigmentation, abnormal AB + MO2-uxt standard conditions Fig. 1 with image from Zhou et al., 2015
trunk vasculature artery hey2 expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 3 with image from Zhou et al., 2015
whole organism nes expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
trunk vasculature kdrl expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
trunk shortened, abnormal AB + MO2-uxt standard conditions Fig. 1 with image from Zhou et al., 2015
hindbrain atrophied, abnormal AB + MO2-uxt standard conditions Fig. 1 with image from Zhou et al., 2015
trunk vasculature artery efnb2a expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 3 with image from Zhou et al., 2015
whole organism ptgs2a expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
caudal fin curled, abnormal AB + MO2-uxt standard conditions Fig. 1 with image from Zhou et al., 2015
whole organism myod1 expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
whole organism her6 expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 5 from Zhou et al., 2015
whole organism hey1 expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 5 from Zhou et al., 2015
whole organism dll4 expression increased amount, abnormal AB + MO2-uxt standard conditions Fig. 5 from Zhou et al., 2015
whole organism flt1 expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
whole organism kdrl expression decreased amount, abnormal AB + MO2-uxt standard conditions Fig. 2 with image from Zhou et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development decreased occurrence, abnormal s843Tg + MO2-uxt control Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis decreased process quality, abnormal s843Tg + MO2-uxt standard conditions Fig. 3 with image,  Fig. 7 with image from Zhou et al., 2015
intersegmental vessel decreased length, abnormal s843Tg + MO2-uxt standard conditions Fig. 3 with image,  Fig. 7 with image from Zhou et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development occurrence, ameliorated s843Tg + MO2-uxt chemical treatment by environment: DAPT Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis process quality, abnormal s843Tg + MO2-uxt standard conditions Fig. 3 with image from Zhou et al., 2015
intersegmental vessel angiogenesis process quality, ameliorated s843Tg + MO2-uxt chemical treatment by environment: DAPT Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis delayed, abnormal y7Tg + MO2-uxt standard conditions Fig. 4 with image from Zhou et al., 2015
intersegmental vessel angiogenesis decreased process quality, abnormal y7Tg + MO2-uxt standard conditions Fig. 4 with image from Zhou et al., 2015
intersegmental vessel decreased length, abnormal y7Tg + MO2-uxt standard conditions Fig. 4 with image from Zhou et al., 2015
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal y7Tg + MO2-uxt standard conditions Fig. 4 with image from Zhou et al., 2015
intersegmental vessel angiogenesis process quality, abnormal y7Tg + MO2-uxt standard conditions Fig. 4 with image from Zhou et al., 2015
endothelial tip cell blood vessel endothelial cell migration decreased rate, abnormal y7Tg + MO2-uxt standard conditions Fig. 4 with image from Zhou et al., 2015
Notch signaling pathway increased occurrence, abnormal jh11Tg; y1Tg + MO2-uxt control Fig. 6 with image from Zhou et al., 2015
trunk mCherry expression increased amount, abnormal jh11Tg; y1Tg + MO2-uxt control Fig. 6 with image from Zhou et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development occurrence, ameliorated s843Tg + MO2-uxt + MO4-rbpja,rbpjb standard conditions Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis process quality, ameliorated s843Tg + MO2-uxt + MO4-rbpja,rbpjb standard conditions Fig. 7 with image from Zhou et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.