Morpholino

MO1-mgaa

ID
ZDB-MRPHLNO-100426-1
Name
MO1-mgaa
Previous Names
  • MO1-mga
Target
Sequence
5' - CATGGGAATTAAGTCATCTGGATAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the 5' UTR of the mature mga transcript.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mgaa
Expressed Gene Anatomy Figures
fabp2 Fig. 6 with image,  Fig. 11 with image from Rikin et al., 2010
foxa2 text only from Rikin et al., 2010
gata4 Fig. 7 with image from Rikin et al., 2010
gata5 Fig. 7 with image,  text only from Rikin et al., 2010
gata6 Fig. 7 with image from Rikin et al., 2010
gsc text only from Rikin et al., 2010
lft2 text only from Rikin et al., 2010
lhx1a text only from Rikin et al., 2010
mixl1 text only from Rikin et al., 2010
nkx2.5 Fig. 7 with image from Rikin et al., 2010
noto text only from Rikin et al., 2010
pitx2 text only from Rikin et al., 2010
sox17 text only from Rikin et al., 2010
sox32 text only from Rikin et al., 2010
tbx5a Fig. 7 with image from Rikin et al., 2010
tbx16 text only from Rikin et al., 2010
tbx16l text only from Rikin et al., 2010
tbx20 Fig. 7 with image from Rikin et al., 2010
tbxta text only from Rikin et al., 2010
tfa Fig. 6 with image,  Fig. 11 with image from Rikin et al., 2010
xbp1 text only from Rikin et al., 2010
Phenotype
Phenotype resulting from MO1-mgaa
Phenotype Fish Figures
ball size, abnormal WT + MO1-mgaa text only from Rikin et al., 2010
blood nucleate erythrocyte decreased amount, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
brain apoptotic, abnormal WT + MO1-mgaa Fig. 3 with image,  Fig. 9 with image,  Fig. 11 with image from Rikin et al., 2010
digestive tract morphogenesis disrupted, abnormal s854Tg + MO1-mgaa Fig. 5 with image from Rikin et al., 2010
extension degenerate, abnormal twu34Tg + MO1-mgaa Fig. 3 with image,  Fig. 8 with image from Rikin et al., 2010
eye decreased size, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
forebrain midbrain boundary amorphous, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
heart looping disrupted, abnormal twu34Tg + MO1-mgaa Fig. 3 with image,  Fig. 4 with image,  Fig. 8 with image from Rikin et al., 2010
heart tube collapsed, abnormal twu34Tg + MO1-mgaa Fig. 4 with image from Rikin et al., 2010
heart tube decreased thickness, abnormal twu34Tg + MO1-mgaa Fig. 4 with image from Rikin et al., 2010
hindbrain aplastic, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
hindbrain apoptotic, abnormal WT + MO1-mgaa Fig. 10 with image from Rikin et al., 2010
hindbrain edematous, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
integument colorless, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
liver aplastic, abnormal s854Tg + MO1-mgaa Fig. 5 with image from Rikin et al., 2010
liver hypoplastic, abnormal WT + MO1-mgaa Fig. 11 with image from Rikin et al., 2010
liver development disrupted, abnormal s854Tg + MO1-mgaa Fig. 5 with image from Rikin et al., 2010
midbrain apoptotic, abnormal WT + MO1-mgaa Fig. 10 with image from Rikin et al., 2010
midbrain hindbrain boundary amorphous, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
pancreas aplastic, abnormal s854Tg + MO1-mgaa Fig. 5 with image from Rikin et al., 2010
pancreas development disrupted, abnormal s854Tg + MO1-mgaa Fig. 5 with image from Rikin et al., 2010
pericardium edematous, abnormal WT + MO1-mgaa Fig. 3 with image,  Fig. 4 with image,  Fig. 8 with image from Rikin et al., 2010
whole organism dead, abnormal WT + MO1-mgaa text only from Rikin et al., 2010
whole organism decreased size, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
Phenotype of all Fish created by or utilizing MO1-mgaa
Phenotype Fish Conditions Figures
hindbrain edematous, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
blood nucleate erythrocyte decreased amount, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
whole organism dead, abnormal WT + MO1-mgaa standard conditions text only from Rikin et al., 2010
whole organism decreased size, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
ball size, abnormal WT + MO1-mgaa standard conditions text only from Rikin et al., 2010
forebrain midbrain boundary amorphous, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
liver hypoplastic, abnormal WT + MO1-mgaa standard conditions Fig. 11 with image from Rikin et al., 2010
eye decreased size, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
heart looping disrupted, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
pericardium edematous, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
integument colorless, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
extension degenerate, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
brain apoptotic, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image,  Fig. 9 with image,  Fig. 11 with image from Rikin et al., 2010
midbrain apoptotic, abnormal WT + MO1-mgaa standard conditions Fig. 10 with image from Rikin et al., 2010
midbrain hindbrain boundary amorphous, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
hindbrain aplastic, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
hindbrain apoptotic, abnormal WT + MO1-mgaa standard conditions Fig. 10 with image from Rikin et al., 2010
pancreas aplastic, abnormal s854Tg + MO1-mgaa standard conditions Fig. 5 with image from Rikin et al., 2010
digestive tract morphogenesis disrupted, abnormal s854Tg + MO1-mgaa standard conditions Fig. 5 with image from Rikin et al., 2010
pancreas development disrupted, abnormal s854Tg + MO1-mgaa standard conditions Fig. 5 with image from Rikin et al., 2010
liver development disrupted, abnormal s854Tg + MO1-mgaa standard conditions Fig. 5 with image from Rikin et al., 2010
liver aplastic, abnormal s854Tg + MO1-mgaa standard conditions Fig. 5 with image from Rikin et al., 2010
pericardium edematous, abnormal twu34Tg + MO1-mgaa standard conditions Fig. 4 with image,  Fig. 8 with image from Rikin et al., 2010
extension degenerate, abnormal twu34Tg + MO1-mgaa standard conditions Fig. 8 with image from Rikin et al., 2010
heart tube decreased thickness, abnormal twu34Tg + MO1-mgaa standard conditions Fig. 4 with image from Rikin et al., 2010
heart looping disrupted, abnormal twu34Tg + MO1-mgaa standard conditions Fig. 4 with image,  Fig. 8 with image from Rikin et al., 2010
heart tube collapsed, abnormal twu34Tg + MO1-mgaa standard conditions Fig. 4 with image from Rikin et al., 2010
liver hypoplastic, abnormal WT + MO1-gata4 + MO1-mgaa standard conditions Fig. 11 with image from Rikin et al., 2010
extension degenerate, abnormal twu34Tg + MO1-gata4 + MO1-mgaa standard conditions Fig. 8 with image from Rikin et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.