Morpholino

MO2-foxi1

ID

ZDB-MRPHLNO-061106-7

Name

MO2-foxi1

Previous Names

foxi1-MO (1)

Target

foxi1 (1)

Sequence

5' - TAATCCGCTCTCCCTCCAGAAACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-foxi1

Expressed Gene	Anatomy	Figures
bmper	whole organism	Fig. 7 from Yao et al., 2014
cdh6	(not) otic vesicle neuroblast (sensu Vertebrata)	Fig. 4 from Hans et al., 2013
cxcr4b	olfactory placode	Fig. 6 from Yao et al., 2014
dlx3b	dorsolateral placode whole organism	Fig. 6 , Fig. 7 from Yao et al., 2014
foxe3	otic vesicle	Fig. 6 from Yao et al., 2014
foxi1	neurogenic field	Fig. 6 from Bhat et al., 2013
hmx3a	dorsolateral placode (not) otic placode neuroblast (sensu Vertebrata) otic vesicle	Fig. 6 from Yao et al., 2014 Fig. 4 from Hans et al., 2013
neurod1	(not) ectoderm	Fig. 4 from Hans et al., 2013
pax2a	(not) epibranchial field midbrain hindbrain boundary neural rod otic placode	Fig. 6 from Yao et al., 2014 Fig. 7 from Sun et al., 2007
six1b	(not) otic placode (not) otic vesicle	Fig. 11, Fig. S2 from Bricaud et al., 2006
six4b	neurogenic field posterior region	Fig. 6 from Yao et al., 2014
sox3	central nervous system epibranchial field	Fig. 6 from Yao et al., 2014 Fig. 7 from Sun et al., 2007
stm	(not) ectoderm otic vesicle	Fig. 4 from Hans et al., 2013 Fig. 7 from Hans et al., 2007

Phenotype

Phenotype resulting from MO2-foxi1

Phenotype	Fish	Figures
adenohypophyseal placode increased size, abnormal	x24Tg + MO2-foxi1 + MO2-gata3	Fig. 4 from Bhat et al., 2013
dorsolateral placode dlx3b expression decreased distribution, abnormal	TU + MO2-foxi1	Fig. 6 from Yao et al., 2014
dorsolateral placode hmx3a expression decreased distribution, abnormal	TU + MO2-foxi1	Fig. 6 from Yao et al., 2014
embryonic viscerocranium morphogenesis disrupted, abnormal	WT + MO2-foxi1	Fig. 1 from Solomon et al., 2003
epibranchial field sox3 expression absent, abnormal	WT + MO2-foxi1	Fig. 7 from Sun et al., 2007
epibranchial field pax2a expression absent, abnormal	WT + MO2-foxi1	Fig. 7 from Sun et al., 2007
epibranchial field sox3 expression decreased distribution, abnormal	TU + MO2-foxi1	Fig. 6 from Yao et al., 2014
facial ganglion absent, abnormal	rw0Tg + MO2-foxi1	Fig. 2 from Lee et al., 2003
glossopharyngeal ganglion absent, abnormal	rw0Tg + MO2-foxi1	Fig. 2 from Lee et al., 2003
mandibular arch skeleton decreased size, abnormal	WT + MO2-foxi1	Fig. 1 from Solomon et al., 2003
neurogenic field posterior region six4b expression decreased amount, abnormal	TU + MO2-foxi1	Fig. 6 from Yao et al., 2014
olfactory pit increased size, abnormal	x24Tg + MO2-foxi1 + MO2-gata3	Fig. 4 from Bhat et al., 2013
otic placode pax2a expression decreased distribution, abnormal	TU + MO2-foxi1	Fig. 6 from Yao et al., 2014
otic vesicle hmx3a expression decreased distribution, abnormal	TU + MO2-foxi1	Fig. 6 from Yao et al., 2014
otic vesicle decreased size, abnormal	WT + MO2-foxi1	Fig. 7 from Hans et al., 2007 Fig. 1 from Solomon et al., 2003
otic vesicle hypoplastic, abnormal	x24Tg + MO2-foxi1 + MO2-gata3	Fig. 4 from Bhat et al., 2013
otic vesicle development disrupted, abnormal	WT + MO2-foxi1	Fig. 1 from Solomon et al., 2003
pharyngeal endoderm apoptotic, abnormal	AB + MO2-foxi1	Fig. 9 from Edlund et al., 2014
vagal ganglion decreased size, abnormal	rw0Tg + MO2-foxi1	Fig. 2 from Lee et al., 2003
vagal ganglion lacks parts or has fewer parts of type vagal ganglion, abnormal	rw0Tg + MO2-foxi1	Fig. 2 from Lee et al., 2003
whole organism bmper expression decreased amount, abnormal	TU + MO2-foxi1	Fig. 7 from Yao et al., 2014
whole organism dlx3b expression decreased amount, abnormal	TU + MO2-foxi1	Fig. 7 from Yao et al., 2014

Phenotype of all Fish created by or utilizing MO2-foxi1

Phenotype	Fish	Conditions	Figures
pharyngeal endoderm apoptotic, abnormal	AB + MO2-foxi1	heat shock	Fig. 9 from Edlund et al., 2014
pharyngeal endoderm apoptotic, abnormal	AB + MO2-foxi1	standard conditions	Fig. 9 from Edlund et al., 2014
dorsolateral placode hmx3a expression decreased distribution, abnormal	TU + MO2-foxi1	control	Fig. 6 from Yao et al., 2014
epibranchial field sox3 expression decreased distribution, abnormal	TU + MO2-foxi1	control	Fig. 6 from Yao et al., 2014
otic placode pax2a expression decreased distribution, abnormal	TU + MO2-foxi1	control	Fig. 6 from Yao et al., 2014
neurogenic field posterior region six4b expression decreased amount, abnormal	TU + MO2-foxi1	control	Fig. 6 from Yao et al., 2014
epibranchial field sox3 expression spatial pattern, ameliorated	TU + MO2-foxi1	chemical treatment: Wnt signalling activator	Fig. 5 from Yao et al., 2014
whole organism bmper expression decreased amount, abnormal	TU + MO2-foxi1	control	Fig. 7 from Yao et al., 2014
otic vesicle hmx3a expression decreased distribution, abnormal	TU + MO2-foxi1	control	Fig. 6 from Yao et al., 2014
otic placode pax2a expression spatial pattern, ameliorated	TU + MO2-foxi1	chemical treatment: Wnt signalling activator	Fig. 5 from Yao et al., 2014
dorsolateral placode dlx3b expression decreased distribution, abnormal	TU + MO2-foxi1	control	Fig. 6 from Yao et al., 2014
whole organism dlx3b expression decreased amount, abnormal	TU + MO2-foxi1	control	Fig. 7 from Yao et al., 2014
mandibular arch skeleton decreased size, abnormal	WT + MO2-foxi1	standard conditions	Fig. 1 from Solomon et al., 2003
otic vesicle development disrupted, abnormal	WT + MO2-foxi1	standard conditions	Fig. 1 from Solomon et al., 2003
embryonic viscerocranium morphogenesis disrupted, abnormal	WT + MO2-foxi1	standard conditions	Fig. 1 from Solomon et al., 2003
epibranchial field pax2a expression absent, abnormal	WT + MO2-foxi1	standard conditions	Fig. 7 from Sun et al., 2007
otic vesicle decreased size, abnormal	WT + MO2-foxi1	standard conditions	Fig. 7 from Hans et al., 2007 Fig. 1 from Solomon et al., 2003
epibranchial field sox3 expression absent, abnormal	WT + MO2-foxi1	standard conditions	Fig. 7 from Sun et al., 2007
vagal ganglion lacks parts or has fewer parts of type vagal ganglion, abnormal	rw0Tg + MO2-foxi1	standard conditions	Fig. 2 from Lee et al., 2003
facial ganglion absent, abnormal	rw0Tg + MO2-foxi1	standard conditions	Fig. 2 from Lee et al., 2003
glossopharyngeal ganglion absent, abnormal	rw0Tg + MO2-foxi1	standard conditions	Fig. 2 from Lee et al., 2003
vagal ganglion decreased size, abnormal	rw0Tg + MO2-foxi1	standard conditions	Fig. 2 from Lee et al., 2003
otic vesicle aplastic, abnormal	WT + MO1-dlx3b + MO2-foxi1	standard conditions	Fig. 7 from Hans et al., 2007
otic vesicle hypoplastic, abnormal	WT + MO1-dlx3b + MO2-foxi1	standard conditions	Fig. 1 from Bhat et al., 2013
trigeminal placode hypoplastic, abnormal	WT + MO2-foxi1 + MO2-gata3	standard conditions	Fig. 4 from Bhat et al., 2013
otic placode hypoplastic, abnormal	WT + MO2-foxi1 + MO2-gata3	standard conditions	Fig. 4 from Bhat et al., 2013
lens morphology, abnormal	WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 4 from Kwon et al., 2010
olfactory pit morphology, abnormal	WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 4 from Kwon et al., 2010
otic vesicle neurogenesis decreased process quality, abnormal	Df(Chr12:dlx3b,dlx4b,tbx6)b380/b380 + MO2-foxi1	standard conditions	Fig. 4 from Hans et al., 2013
otic vesicle malformed, abnormal	Df(Chr12:dlx3b,dlx4b,tbx6)b380/b380 + MO2-foxi1	standard conditions	Fig. 4 from Hans et al., 2013
otic vesicle morphogenesis decreased process quality, abnormal	Df(Chr12:dlx3b,dlx4b,tbx6)b380/b380 + MO2-foxi1	standard conditions	Fig. 4 from Hans et al., 2013
otic vesicle decreased size, abnormal	b1193Tg + MO2-foxi1 (AB)	heat shock	Fig. 7 from Hans et al., 2007
adenohypophyseal placode increased size, abnormal	x24Tg + MO2-foxi1 + MO2-gata3	heat shock	Fig. 4 from Bhat et al., 2013
olfactory pit increased size, abnormal	x24Tg + MO2-foxi1 + MO2-gata3	heat shock	Fig. 4 from Bhat et al., 2013
otic vesicle hypoplastic, abnormal	x24Tg + MO2-foxi1 + MO2-gata3	heat shock	Fig. 4 from Bhat et al., 2013
otic vesicle aplastic, abnormal	b1193Tg + MO1-dlx3b + MO2-foxi1 (AB)	heat shock	Fig. 7 from Hans et al., 2007

Citations