Morpholino

MO1-myf5

ID
ZDB-MRPHLNO-060322-3
Name
MO1-myf5
Previous Names
  • MO2-myf5
Target
Sequence
5' - TACGTCCATGATTGGTTTGGTGTTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myf5
Expressed Gene Anatomy Figures
bmp4 Fig. 8 from Lin et al., 2013
col2a1a Fig. 1 from Lin et al., 2013
dlx2a Fig. 2 from Lin et al., 2013
edn1 Fig. 3 with image from Lin et al., 2006
etv4 Fig. 3 from Lin et al., 2013
etv5b Fig. 3 from Lin et al., 2013
fgf3 Fig. 4,  Fig. 8 from Lin et al., 2013
fgf8a Fig. 4,  Fig. 8 from Lin et al., 2013
foxd3 Fig. 4 from Lin et al., 2013
gsc Fig. 7 from Lin et al., 2013
her1 Fig. 7 from Lin et al., 2013
met Fig. 7 with image,  Fig. 8 with image from Lin et al., 2006
myf6 Fig. 3 from Schnapp et al., 2009
myod1 Fig. 7 from Schnapp et al., 2009
Fig. 3 with image,  Fig. 6 with image from Lin et al., 2006
myog Fig. 7 with image from Lee et al., 2006
Fig. 3 with image,  Fig. 6 with image,  Fig. 8 with image from Lin et al., 2006
noto Fig. 7 from Lin et al., 2013
scxa Fig. 5 with image from Chen et al., 2014
sox9a Fig. 4 from Lin et al., 2013
tbx1 Fig. 7 from Lin et al., 2013
xirp2a Fig. 5 with image from Chen et al., 2014
Phenotype
Phenotype resulting from MO1-myf5
Phenotype Fish Figures
cephalic musculature decreased amount, abnormal WT + MO1-myf5 Fig. 3 with image,  Fig. 7 with image,  Fig. 8 with image from Lin et al., 2006
ceratobranchial cartilage absent, abnormal AB + MO1-myf5 Fig. 1,  Fig. 3 from Lin et al., 2013
ceratohyal cartilage malformed, abnormal twu3Tg + MO1-myf5 Fig. 1,  Fig. 3 from Lin et al., 2013
copula absent, abnormal twu3Tg + MO1-myf5 Fig. 1 from Lin et al., 2013
cranial neural crest decreased amount, abnormal AB + MO1-myf5 Fig. 2 from Lin et al., 2013
cranial neural crest chondroblast decreased amount, abnormal AB + MO1-myf5 Fig. 2 from Lin et al., 2013
head decreased size, abnormal twu3Tg + MO1-myf5 Fig. 1 from Lin et al., 2013
head lacks parts or has fewer parts of type cephalic musculature, abnormal twu3Tg + MO1-myf5 Fig. 1 from Lin et al., 2013
hypobranchial cartilage absent, abnormal twu3Tg + MO1-myf5 Fig. 1 from Lin et al., 2013
Meckel's cartilage malformed, abnormal AB + MO1-myf5 Fig. 1,  Fig. 3 from Lin et al., 2013
neuroectoderm neural crest cell decreased amount, abnormal AB + MO1-myf5 Fig. 4 from Lin et al., 2013
palatoquadrate cartilage malformed, abnormal twu3Tg + MO1-myf5 Fig. 1,  Fig. 3 from Lin et al., 2013
pharyngeal arch 3 has fewer parts of type chondroblast, abnormal AB + MO1-myf5 Fig. 2 from Lin et al., 2013
pharyngeal arch 3 has fewer parts of type cranial neural crest, abnormal AB + MO1-myf5 Fig. 2 from Lin et al., 2013
pharyngeal arch 3-7 skeleton absent, abnormal AB + MO1-myf5 Fig. 3 from Lin et al., 2013
pharyngeal arch 4 has fewer parts of type cranial neural crest, abnormal AB + MO1-myf5 Fig. 2,  Fig. 3 from Lin et al., 2013
pharyngeal arch 5 absent, abnormal AB + MO1-myf5 Fig. 2 from Lin et al., 2013
pharyngeal arch 5 has fewer parts of type cranial neural crest, abnormal AB + MO1-myf5 Fig. 2 from Lin et al., 2013
pharyngeal arch 6 absent, abnormal AB + MO1-myf5 Fig. 2 from Lin et al., 2013
pharyngeal arch 6 has fewer parts of type cranial neural crest, abnormal AB + MO1-myf5 Fig. 2 from Lin et al., 2013
presumptive cephalic mesoderm gene expression disrupted, abnormal AB + MO1-myf5 Fig. 4 from Lin et al., 2013
shield increased width, abnormal AB + MO1-myf5 Fig. 8 from Lin et al., 2013
Phenotype of all Fish created by or utilizing MO1-myf5
Phenotype Fish Conditions Figures
cranial neural crest chondroblast decreased amount, abnormal AB + MO1-myf5 standard conditions Fig. 2 from Lin et al., 2013
pharyngeal arch 3 has fewer parts of type cranial neural crest, abnormal AB + MO1-myf5 standard conditions Fig. 2 from Lin et al., 2013
pharyngeal arch 3 has fewer parts of type chondroblast, abnormal AB + MO1-myf5 standard conditions Fig. 2 from Lin et al., 2013
ceratohyal cartilage malformed, abnormal AB + MO1-myf5 standard conditions Fig. 3 from Lin et al., 2013
pharyngeal arch 6 has fewer parts of type cranial neural crest, abnormal AB + MO1-myf5 standard conditions Fig. 2 from Lin et al., 2013
ceratobranchial cartilage absent, abnormal AB + MO1-myf5 standard conditions Fig. 3 from Lin et al., 2013
presumptive cephalic mesoderm gene expression disrupted, abnormal AB + MO1-myf5 standard conditions Fig. 4 from Lin et al., 2013
Meckel's cartilage malformed, abnormal AB + MO1-myf5 standard conditions Fig. 3 from Lin et al., 2013
pharyngeal arch 5 has fewer parts of type cranial neural crest, abnormal AB + MO1-myf5 standard conditions Fig. 2 from Lin et al., 2013
pharyngeal arch 6 absent, abnormal AB + MO1-myf5 standard conditions Fig. 2 from Lin et al., 2013
pharyngeal arch 3-7 skeleton absent, abnormal AB + MO1-myf5 standard conditions Fig. 3 from Lin et al., 2013
pharyngeal arch 5 absent, abnormal AB + MO1-myf5 standard conditions Fig. 2 from Lin et al., 2013
palatoquadrate cartilage malformed, abnormal AB + MO1-myf5 standard conditions Fig. 3 from Lin et al., 2013
pharyngeal arch 4 has fewer parts of type cranial neural crest, abnormal AB + MO1-myf5 standard conditions Fig. 2,  Fig. 3 from Lin et al., 2013
shield increased width, abnormal AB + MO1-myf5 standard conditions Fig. 8 from Lin et al., 2013
neuroectoderm neural crest cell decreased amount, abnormal AB + MO1-myf5 standard conditions Fig. 4 from Lin et al., 2013
cranial neural crest decreased amount, abnormal AB + MO1-myf5 standard conditions Fig. 2 from Lin et al., 2013
cephalic musculature decreased amount, abnormal WT + MO1-myf5 standard conditions Fig. 3 with image,  Fig. 7 with image,  Fig. 8 with image from Lin et al., 2006
palatoquadrate cartilage malformed, abnormal twu3Tg + MO1-myf5 standard conditions Fig. 1 from Lin et al., 2013
head decreased size, abnormal twu3Tg + MO1-myf5 standard conditions Fig. 1 from Lin et al., 2013
copula absent, abnormal twu3Tg + MO1-myf5 standard conditions Fig. 1 from Lin et al., 2013
Meckel's cartilage malformed, abnormal twu3Tg + MO1-myf5 standard conditions Fig. 1 from Lin et al., 2013
ceratohyal cartilage malformed, abnormal twu3Tg + MO1-myf5 standard conditions Fig. 1 from Lin et al., 2013
hypobranchial cartilage absent, abnormal twu3Tg + MO1-myf5 standard conditions Fig. 1 from Lin et al., 2013
ceratobranchial cartilage absent, abnormal twu3Tg + MO1-myf5 standard conditions Fig. 1 from Lin et al., 2013
head lacks parts or has fewer parts of type cephalic musculature, abnormal twu3Tg + MO1-myf5 standard conditions Fig. 1 from Lin et al., 2013
muscle sarcomere disorganized, abnormal AB + MO1-myf5 + MO1-myod1 standard conditions Fig. 5 from Schnapp et al., 2009
muscle disorganized, abnormal AB + MO1-myf5 + MO1-myod1 standard conditions Fig. 5 from Schnapp et al., 2009
whole organism movement quality, abnormal AB + MO1-myf5 + MO1-myod1 standard conditions Fig. 1 from Schnapp et al., 2009
muscle apoptotic, abnormal AB + MO1-myf5 + MO1-myod1 standard conditions Fig. 5 from Schnapp et al., 2009
muscle sarcomere disoriented, abnormal AB + MO1-myf5 + MO1-myod1 standard conditions Fig. 5 from Schnapp et al., 2009
cephalic musculature decreased amount, abnormal WT + MO1-myf5 + MO1-myod1 standard conditions Fig. 5 with image from Lin et al., 2006
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.