Morpholino

MO3-tbx16

ID
ZDB-MRPHLNO-060111-5
Name
MO3-tbx16
Previous Names
None
Target
Sequence
5' - GCTTGAGGTCTCTGATAGCCTGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-tbx16
Expressed Gene Anatomy Figures
cp Fig. 5 with image from Nelson et al., 2017
fgf3 Fig. 4 with image from Osborn et al., 2020
fgf4 Fig. 4 with image from Osborn et al., 2020
fgf8a Fig. 4 with image from Osborn et al., 2020
foxa3 Fig. 5 with image from Nelson et al., 2017
ins Fig. 5 with image from Nelson et al., 2017
lft1 Fig. 5 with image from Amack et al., 2007
lft2 Fig. 5 with image from Amack et al., 2007
mixl1 Fig. 4 with image from Nelson et al., 2017
myf5 Fig. 4 with image from Osborn et al., 2020
myod1 Fig. 4 with image from Osborn et al., 2020
Fig. S3 with image from Amack et al., 2007
sdc2 Fig. S2 with image from Arrington et al., 2013
shha Fig. 5 with image,  Fig. S3 with image from Amack et al., 2007
sox17 Fig. 4 with image from Nelson et al., 2017
text only from Amack et al., 2007
sox32 Fig. 4 with image from Nelson et al., 2017
spaw Fig. 5 with image from Amack et al., 2007
tbx16 Fig. 4 with image,  Fig. 6 with image from Amack et al., 2007
tbxta Fig. 6 with image from Amack et al., 2007
Phenotype
Phenotype resulting from MO3-tbx16
Phenotype Fish Figures
axial chorda mesoderm fgf8a expression decreased distribution, abnormal WT + MO3-tbx16 Fig. 4 with image from Osborn et al., 2020
determination of digestive tract left/right asymmetry decreased occurrence, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
determination of left/right symmetry disrupted, abnormal AB + MO3-tbx16 Fig. 5 with image from Amack et al., 2007
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
determination of pancreatic left/right asymmetry decreased occurrence, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
diencephalon mislocalised, abnormal AB + MO3-tbx16 Fig. 5 with image from Amack et al., 2007
digestive system foxa3 expression spatial pattern, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
endoderm sox17 expression decreased amount, abnormal AB + MO3-tbx16 Fig. 4 with image from Nelson et al., 2017
endoderm EGFP expression decreased amount, abnormal ha01Tg + MO3-tbx16 Fig. 4 with image from Nelson et al., 2017
endoderm EGFP expression spatial pattern, abnormal ha01Tg + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
endodermal cell decreased amount, abnormal AB + MO3-tbx16 Fig. 4 with image from Nelson et al., 2017
gut malformed, abnormal ha01Tg + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
heart rudiment mislocalised, abnormal AB + MO3-tbx16 Fig. 5 with image from Amack et al., 2007
Kupffer's vesicle decreased size, abnormal AB + MO3-tbx16 Fig. 5 with image,  Fig. 7 with image from Amack et al., 2007
Kupffer's vesicle malformed, abnormal AB + MO3-tbx16 Fig. 5 with image,  Fig. 7 with image from Amack et al., 2007
liver cp expression decreased amount, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
liver position, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
liver cp expression spatial pattern, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
liver development decreased occurrence, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
liver development process quality, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
margin fgf8a expression increased distribution, abnormal WT + MO3-tbx16 Fig. 4 with image from Osborn et al., 2020
notochord kinked, abnormal AB + MO3-tbx16 Fig. 5 with image from Amack et al., 2007
notochord posterior-most region fgf3 expression increased distribution, abnormal WT + MO3-tbx16 Fig. 4 with image from Osborn et al., 2020
notochord posterior-most region fgf8a expression increased distribution, abnormal WT + MO3-tbx16 Fig. 4 with image from Osborn et al., 2020
notochord posterior-most region fgf4 expression increased distribution, abnormal WT + MO3-tbx16 Fig. 4 with image from Osborn et al., 2020
pancreas ins expression decreased amount, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
pancreas position, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
pancreas ins expression spatial pattern, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
pancreas development decreased occurrence, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
pancreas development process quality, abnormal AB + MO3-tbx16 Fig. 5 with image from Nelson et al., 2017
post-vent region shape, abnormal AB + MO3-tbx16 Fig. 5 with image,  Fig. 8 with image from Amack et al., 2007
presumptive endoderm sox32 expression decreased amount, abnormal AB + MO3-tbx16 Fig. 4 with image from Nelson et al., 2017
presumptive paraxial mesoderm myod1 expression absent, abnormal WT + MO3-tbx16 Fig. 4 with image from Osborn et al., 2020
presumptive paraxial mesoderm myf5 expression decreased distribution, abnormal WT + MO3-tbx16 Fig. 4 with image from Osborn et al., 2020
segmental plate adaxial cell myod1 expression decreased distribution, abnormal WT + MO3-tbx16 Fig. 4 with image from Osborn et al., 2020
segmental plate adaxial cell myf5 expression decreased distribution, abnormal WT + MO3-tbx16 Fig. 4 with image from Osborn et al., 2020
somite adaxial cell myf5 expression decreased distribution, abnormal WT + MO3-tbx16 Fig. 4 with image from Osborn et al., 2020
tail bud myf5 expression decreased distribution, abnormal WT + MO3-tbx16 Fig. 4 with image from Osborn et al., 2020
trunk morphology, abnormal AB + MO3-tbx16 Fig. 5 with image,  Fig. 8 with image from Amack et al., 2007
whole organism sox32 expression decreased amount, abnormal AB + MO3-tbx16 Fig. 4 with image from Nelson et al., 2017
whole organism mixl1 expression decreased amount, abnormal AB + MO3-tbx16 Fig. 4 with image from Nelson et al., 2017
Phenotype of all Fish created by or utilizing MO3-tbx16
Phenotype Fish Conditions Figures
trunk morphology, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image,  Fig. 8 with image from Amack et al., 2007
liver development decreased occurrence, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
Kupffer's vesicle malformed, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image,  Fig. 7 with image from Amack et al., 2007
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
determination of pancreatic left/right asymmetry decreased occurrence, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
determination of left/right symmetry disrupted, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Amack et al., 2007
pancreas development decreased occurrence, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
pancreas development process quality, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
notochord kinked, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Amack et al., 2007
digestive system foxa3 expression spatial pattern, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
pancreas ins expression spatial pattern, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
determination of digestive tract left/right asymmetry decreased occurrence, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
pancreas position, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
diencephalon mislocalised, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Amack et al., 2007
liver position, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
whole organism sox32 expression decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
pancreas ins expression decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
Kupffer's vesicle decreased size, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image,  Fig. 7 with image from Amack et al., 2007
heart rudiment mislocalised, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Amack et al., 2007
liver cp expression decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
post-vent region shape, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image,  Fig. 8 with image from Amack et al., 2007
liver cp expression spatial pattern, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
whole organism mixl1 expression decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
endoderm sox17 expression decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
liver development process quality, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
presumptive endoderm sox32 expression decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
endodermal cell decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
somite myod1 expression decreased distribution, abnormal WT + MO3-tbx16 chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
notochord posterior-most region fgf4 expression increased distribution, abnormal WT + MO3-tbx16 standard conditions Fig. 4 with image from Osborn et al., 2020
margin fgf8a expression increased distribution, abnormal WT + MO3-tbx16 standard conditions Fig. 4 with image from Osborn et al., 2020
notochord posterior-most region fgf3 expression increased distribution, abnormal WT + MO3-tbx16 standard conditions Fig. 4 with image from Osborn et al., 2020
presumptive paraxial mesoderm myod1 expression absent, abnormal WT + MO3-tbx16 standard conditions Fig. 4 with image from Osborn et al., 2020
notochord posterior-most region fgf8a expression increased distribution, abnormal WT + MO3-tbx16 standard conditions Fig. 4 with image from Osborn et al., 2020
tail bud myf5 expression decreased distribution, abnormal WT + MO3-tbx16 standard conditions Fig. 4 with image from Osborn et al., 2020
somite adaxial cell myf5 expression decreased distribution, abnormal WT + MO3-tbx16 standard conditions Fig. 4 with image from Osborn et al., 2020
tail bud myod1 expression absent, abnormal WT + MO3-tbx16 chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
adaxial cell myf5 expression absent, abnormal WT + MO3-tbx16 chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
axial chorda mesoderm fgf8a expression decreased distribution, abnormal WT + MO3-tbx16 standard conditions Fig. 4 with image from Osborn et al., 2020
segmental plate adaxial cell myod1 expression absent, abnormal WT + MO3-tbx16 chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
somite adaxial cell myod1 expression absent, abnormal WT + MO3-tbx16 chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
segmental plate adaxial cell myf5 expression decreased distribution, abnormal WT + MO3-tbx16 standard conditions Fig. 4 with image from Osborn et al., 2020
presumptive paraxial mesoderm myf5 expression decreased distribution, abnormal WT + MO3-tbx16 standard conditions Fig. 4 with image from Osborn et al., 2020
segmental plate adaxial cell myod1 expression decreased distribution, abnormal WT + MO3-tbx16 standard conditions Fig. 4 with image from Osborn et al., 2020
gut malformed, abnormal ha01Tg + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
endoderm EGFP expression spatial pattern, abnormal ha01Tg + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal ha01Tg + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
endoderm EGFP expression decreased amount, abnormal ha01Tg + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
determination of left/right asymmetry in lateral mesoderm process quality, abnormal AB + MO1-fgf2 + MO3-tbx16 standard conditions Fig. 5 with image from Arrington et al., 2013
post-vent region shape, abnormal AB + MO1-tbxta + MO3-tbx16 standard conditions Fig. 8 with image from Amack et al., 2007
Kupffer's vesicle ciliated cell absent, abnormal AB + MO1-tbxta + MO3-tbx16 standard conditions Fig. 8 with image from Amack et al., 2007
trunk morphology, abnormal AB + MO1-tbxta + MO3-tbx16 standard conditions Fig. 8 with image from Amack et al., 2007
pancreas development decreased occurrence, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
whole organism sox32 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
whole organism mixl1 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
determination of digestive tract left/right asymmetry decreased occurrence, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
liver cp expression absent, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
anatomical structure cxcl12b expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
pancreas ins expression absent, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
liver development decreased occurrence, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
endoderm sox17 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
whole organism gata5 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
endodermal cell decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
presumptive endoderm sox32 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
digestive system foxa3 expression spatial pattern, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
anatomical structure cxcl12a expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
determination of left/right asymmetry in lateral mesoderm process quality, abnormal AB + MO3-tbx16 + MO5-sdc2 standard conditions Fig. 5 with image from Arrington et al., 2013
gut malformed, abnormal ha01Tg + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
endoderm EGFP expression spatial pattern, abnormal ha01Tg + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal ha01Tg + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
endoderm EGFP expression decreased amount, abnormal ha01Tg + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.