Morpholino

MO1-ippk

ID

ZDB-MRPHLNO-050830-1

Name

MO1-ippk

Previous Names

ipk1 MO1 (1)
MO1-ipk1l (1)

Target

ippk (1)

Sequence

5' - GTCCATTTTATCCAGTTCCATAACC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ippk

Expressed Gene	Anatomy	Figures
bmp4	heart primordium	Fig. 4 from Sarmah et al., 2005
col2a1a	floor plate hypochord	Fig. S3 from Sarmah et al., 2005
dlc	segmental plate somite	Fig. S6 from Sarmah et al., 2007
egr2b	presumptive rhombomere 3 presumptive rhombomere 5	Fig. S6 from Sarmah et al., 2007
foxa3	liver pancreas	Fig. 4 from Sarmah et al., 2005
gata6	gut heart tube	Fig. 4 from Sarmah et al., 2005
ippk	margin shield tail bud (not) whole organism	Fig. S2, Fig. S4 from Sarmah et al., 2005
lft1	axial mesoderm diencephalon heart primordium margin	Fig. 4, Fig. 5 from Sarmah et al., 2005
myod1	somite	Fig. S6 from Sarmah et al., 2007
ntn1b	floor plate	Fig. S3 from Sarmah et al., 2005
pitx2	lateral plate mesoderm unspecified	Fig. 4, Fig. 5 from Sarmah et al., 2005
spaw	lateral mesoderm lateral plate mesoderm tail bud	Fig. 4, Fig. 5 from Sarmah et al., 2005
tbxta	axial mesoderm forerunner cell group margin notochord	Fig. 5, Fig. S3 from Sarmah et al., 2005

Phenotype

Phenotype resulting from MO1-ippk

Phenotype	Fish	Figures
central canal cilium decreased functionality, abnormal	WT + MO1-ippk	Fig. 1 from Sarmah et al., 2007
central canal cilium decreased length, abnormal	WT + MO1-ippk	Fig. 1 , Fig. S5 from Sarmah et al., 2007
determination of heart left/right asymmetry disrupted, abnormal	WT + MO1-ippk	Fig. 4 from Jao et al., 2017 Fig. 1 from Sarmah et al., 2010
heart looping disrupted, abnormal	vu504Tg + MO1-ippk	Fig. 4 from Jao et al., 2017
heart tube position, abnormal	vu504Tg + MO1-ippk	Fig. 4 from Jao et al., 2017 Fig. S7 from Sarmah et al., 2007
Kupffer's vesicle cilium decreased functionality, abnormal	WT + MO1-ippk	Fig. 1 from Sarmah et al., 2007
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-ippk	Fig. 1 from Sarmah et al., 2007
Kupffer's vesicle cilium movement decreased rate, abnormal	AB + MO1-ippk	Fig. 4 from Jao et al., 2017
pronephric duct cilium decreased functionality, abnormal	WT + MO1-ippk	Fig. 1 from Sarmah et al., 2007
pronephric duct cilium decreased length, abnormal	WT + MO1-ippk	Fig. 1 , Fig. S5 from Sarmah et al., 2007

Phenotype of all Fish created by or utilizing MO1-ippk

Phenotype	Fish	Conditions	Figures
Kupffer's vesicle cilium movement decreased rate, abnormal	AB + MO1-ippk	control	Fig. 4 from Jao et al., 2017
determination of heart left/right asymmetry disrupted, abnormal	WT + MO1-ippk	standard conditions	Fig. 1 from Sarmah et al., 2010
heart tube position, abnormal	WT + MO1-ippk	standard conditions	Fig. S7 from Sarmah et al., 2007
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-ippk	standard conditions	Fig. 1 from Sarmah et al., 2007
pronephric duct cilium decreased length, abnormal	WT + MO1-ippk	standard conditions	Fig. 1 , Fig. S5 from Sarmah et al., 2007
Kupffer's vesicle cilium decreased functionality, abnormal	WT + MO1-ippk	standard conditions	Fig. 1 from Sarmah et al., 2007
central canal cilium decreased length, abnormal	WT + MO1-ippk	standard conditions	Fig. 1 , Fig. S5 from Sarmah et al., 2007
pronephric duct cilium decreased functionality, abnormal	WT + MO1-ippk	standard conditions	Fig. 1 from Sarmah et al., 2007
central canal cilium decreased functionality, abnormal	WT + MO1-ippk	standard conditions	Fig. 1 from Sarmah et al., 2007
heart looping disrupted, abnormal	vu504Tg + MO1-ippk	control	Fig. 4 from Jao et al., 2017
heart tube position, abnormal	vu504Tg + MO1-ippk	control	Fig. 4 from Jao et al., 2017
determination of heart left/right asymmetry disrupted, abnormal	vu504Tg + MO1-ippk	control	Fig. 4 from Jao et al., 2017
heart tube position, abnormal	ift88^tz288/+ + MO1-ippk	standard conditions	Fig. 3 , Fig. S7 from Sarmah et al., 2007
heart tube position, abnormal	WT + MO1-ift57 + MO1-ippk	standard conditions	Fig. 3 , Fig. S7 from Sarmah et al., 2007
heart tube position, abnormal	WT + MO1-ift88 + MO1-ippk	standard conditions	Fig. 3 , Fig. S7 from Sarmah et al., 2007
heart looping disrupted, abnormal	vu504Tg + MO1-gle1 + MO1-ippk + MO2-gle1	standard conditions	Fig. 4 from Jao et al., 2017
heart tube position, abnormal	vu504Tg + MO1-gle1 + MO1-ippk + MO2-gle1	standard conditions	Fig. 4 from Jao et al., 2017
determination of heart left/right asymmetry disrupted, abnormal	vu504Tg + MO1-gle1 + MO1-ippk + MO2-gle1	standard conditions	Fig. 4 from Jao et al., 2017

Citations