Morpholino

MO1-hoxb1a

ID

ZDB-MRPHLNO-050825-1

Name

MO1-hoxb1a

Previous Names

None

Target

hoxb1a (1)

Sequence

5' - GGAACTGTCCATACGCAATTAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hoxb1a

Expressed Gene	Anatomy	Figures
ca2	facial nerve motor nucleus rhombomere 2 rhombomere 4 rhombomere 5 rhombomere 6 trigeminal motor nucleus	Fig. 4 from Rohrschneider et al., 2007
calb2b	hindbrain (not) rhombomere 4	Fig. 4 from Rohrschneider et al., 2007
col7a1l	rhombomere 4	Fig. 3 from Rohrschneider et al., 2007
egr2b	rhombomere 3 rhombomere 5	Fig. 4 from Rohrschneider et al., 2007
fabp7a	rhombomere 4	Fig. 3 from Rohrschneider et al., 2007
hoxb1a	rhombomere 4	Fig. 3 from Rohrschneider et al., 2007
mecom	rhombomere 4	Fig. 3 from Rohrschneider et al., 2007
meis2b	rhombomere 4	Fig. 3 from Rohrschneider et al., 2007
pou4f2	rhombomere 3 rhombomere 4 rhombomere 5	Fig. 4 from Rohrschneider et al., 2007
prickle1b	(not) rhombomere 4 (not) rhombomere 5 (not) rhombomere 6	Fig. 4 from Rohrschneider et al., 2007
raraa	(not) rhombomere 4	Fig. 3 from Rohrschneider et al., 2007
slc1a2b	hindbrain (not) rhombomere 4	Fig. 3 from Rohrschneider et al., 2007
zic1	neural tube rhombomere 4	Fig. 3 from Rohrschneider et al., 2007
zic4	neural tube rhombomere 4	Fig. 3 from Rohrschneider et al., 2007

Phenotype

Phenotype resulting from MO1-hoxb1a

Phenotype	Fish	Figures
cell migration in hindbrain disrupted, abnormal	rw0Tg + MO1-hoxb1a	Fig. 5 from Hurley et al., 2007
facial nerve development disrupted, abnormal	rw0Tg + MO1-hoxb1a	Fig. 5 from Hurley et al., 2007
hindbrain neuron mislocalised, abnormal	rw0Tg + MO1-hoxb1a	Fig. 5 from Hurley et al., 2007
neuron migration disrupted, abnormal	rw0Tg + MO1-hoxb1a	Fig. 5 from Hurley et al., 2007
rhombomere 4 development disrupted, abnormal	WT + MO1-hoxb1a	Fig. 3 , Fig. 4 from Rohrschneider et al., 2007

Phenotype of all Fish created by or utilizing MO1-hoxb1a

Phenotype	Fish	Conditions	Figures
rhombomere 4 development disrupted, abnormal	WT + MO1-hoxb1a	standard conditions	Fig. 3 , Fig. 4 from Rohrschneider et al., 2007
facial nerve development disrupted, abnormal	rw0Tg + MO1-hoxb1a	standard conditions	Fig. 5 from Hurley et al., 2007
neuron migration disrupted, abnormal	rw0Tg + MO1-hoxb1a	standard conditions	Fig. 5 from Hurley et al., 2007
hindbrain neuron mislocalised, abnormal	rw0Tg + MO1-hoxb1a	standard conditions	Fig. 5 from Hurley et al., 2007
cell migration in hindbrain disrupted, abnormal	rw0Tg + MO1-hoxb1a	standard conditions	Fig. 5 from Hurley et al., 2007
rhombomere 4 tshz3b expression absent, abnormal	AB + MO1-hoxb1a + MO1-hoxb1b	control	Fig. 2 from Erickson et al., 2011
presumptive rhombomere 4 tshz3b expression decreased amount, abnormal	AB + MO1-hoxb1a + MO1-hoxb1b	control	Fig. 2 from Erickson et al., 2011
trunk axis tshz3b expression decreased amount, abnormal	AB + MO1-hoxb1a + MO1-hoxb1b	control	Fig. 2 from Erickson et al., 2011
presumptive rhombomere 4 znf703 expression decreased amount, abnormal	WT + MO1-hoxb1a + MO1-hoxb1b	standard conditions	Fig. 2 from Labalette et al., 2015
presumptive rhombomere 4 egr2b expression mislocalised, abnormal	WT + MO1-hoxb1a + MO1-hoxb1b	standard conditions	Fig. 1 from Labalette et al., 2015
presumptive rhombomere 3 znf703 expression decreased amount, abnormal	WT + MO1-hoxb1a + MO1-hoxb1b	standard conditions	Fig. 2 from Labalette et al., 2015
rhombomere 4 egr2b expression mislocalised, abnormal	WT + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal	WT + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
presumptive rhombomere 4 egr2b expression mislocalised, abnormal	egr2b^fh227/fh227 + MO1-hoxb1a + MO1-hoxb1b	standard conditions	Fig. 1 from Labalette et al., 2015
presumptive rhombomere 3 egr2b expression increased distribution, abnormal	egr2b^fh227/fh227 + MO1-hoxb1a + MO1-hoxb1b	standard conditions	Fig. 1 from Labalette et al., 2015
rhombomere 4 Citrine expression increased distribution, abnormal	fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal	fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
presumptive rhombomere 4 GFP expression decreased amount, abnormal	zf1077Tg + MO1-hoxb1a + MO1-hoxb1b	standard conditions	Fig. 4 from Labalette et al., 2015
presumptive rhombomere 3 GFP expression decreased amount, abnormal	zf1077Tg + MO1-hoxb1a + MO1-hoxb1b	standard conditions	Fig. 4 from Labalette et al., 2015

Citations