Morpholino

MO1-hoxb1a

ID
ZDB-MRPHLNO-050825-1
Name
MO1-hoxb1a
Previous Names
None
Target
Sequence
5' - GGAACTGTCCATACGCAATTAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hoxb1a
Phenotype
Phenotype resulting from MO1-hoxb1a
Phenotype of all Fish created by or utilizing MO1-hoxb1a
Phenotype Fish Conditions Figures
rhombomere 4 development disrupted, abnormal WT + MO1-hoxb1a standard conditions Fig. 3 with imageFig. 4 with image from Rohrschneider et al., 2007
facial nerve development disrupted, abnormal rw0Tg + MO1-hoxb1a standard conditions Fig. 5 from Hurley et al., 2007
neuron migration disrupted, abnormal rw0Tg + MO1-hoxb1a standard conditions Fig. 5 from Hurley et al., 2007
hindbrain neuron mislocalised, abnormal rw0Tg + MO1-hoxb1a standard conditions Fig. 5 from Hurley et al., 2007
cell migration in hindbrain disrupted, abnormal rw0Tg + MO1-hoxb1a standard conditions Fig. 5 from Hurley et al., 2007
rhombomere 4 tshz3b expression absent, abnormal AB + MO1-hoxb1a + MO1-hoxb1b control Fig. 2 from Erickson et al., 2011
presumptive rhombomere 4 tshz3b expression decreased amount, abnormal AB + MO1-hoxb1a + MO1-hoxb1b control Fig. 2 from Erickson et al., 2011
trunk axis tshz3b expression decreased amount, abnormal AB + MO1-hoxb1a + MO1-hoxb1b control Fig. 2 from Erickson et al., 2011
presumptive rhombomere 4 znf703 expression decreased amount, abnormal WT + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 2 with image from Labalette et al., 2015
presumptive rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 1 with image from Labalette et al., 2015
presumptive rhombomere 3 znf703 expression decreased amount, abnormal WT + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 2 with image from Labalette et al., 2015
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
presumptive rhombomere 4 egr2b expression mislocalised, abnormal egr2bfh227/fh227 + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 1 with image from Labalette et al., 2015
presumptive rhombomere 3 egr2b expression increased distribution, abnormal egr2bfh227/fh227 + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 1 with image from Labalette et al., 2015
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
presumptive rhombomere 4 GFP expression decreased amount, abnormal zf1077Tg + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 4 with image from Labalette et al., 2015
presumptive rhombomere 3 GFP expression decreased amount, abnormal zf1077Tg + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 4 with image from Labalette et al., 2015
Citations