Morpholino

MO1-foxa2

ID

ZDB-MRPHLNO-050228-2

Name

MO1-foxa2

Previous Names

None

Target

foxa2 (1)

Sequence

5' - CCTCCATTTTGACAGCACCGAGCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

MODB:104 (2)
MODB:847 (2)

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-foxa2

Expressed Gene	Anatomy	Figures
agr2	(not) intestine goblet cell pharynx	Fig. 4, Fig. 5 from Lai et al., 2016
col2a1a	floor plate hypochord	Fig. 1 from Dal-Pra et al., 2011
foxa3	gut liver pancreas	Fig. 7 from Shin et al., 2008
im:7144261	notochord	Fig. 1 from Dal-Pra et al., 2011
muc2.1	intestine goblet cell	Fig. S10 from Lai et al., 2016
myf5	presumptive paraxial mesoderm	Fig. 3 from Dal-Pra et al., 2011
shha	pharynx	Fig. 5 from Lai et al., 2016
spon1b	floor plate	Fig. 1 from Dal-Pra et al., 2011
twist2	axial chorda mesoderm	Fig. 3 from Dal-Pra et al., 2011

Phenotype

Phenotype resulting from MO1-foxa2

Phenotype	Fish	Figures
exocrine pancreas decreased size, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	Fig. 7 from Shin et al., 2008
floor plate undifferentiated, abnormal	WT + MO1-foxa2	Fig. 1 from Dal-Pra et al., 2011
liver decreased size, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	Fig. 7 from Shin et al., 2008
liver development disrupted, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	Fig. 7 from Shin et al., 2008
pancreas decreased size, abnormal	WT + MO1-foxa2	Fig. 7 from Shin et al., 2008
pancreas development disrupted, abnormal	WT + MO1-foxa2	Fig. 7 from Shin et al., 2008
post-vent region curved ventral, abnormal	WT + MO1-foxa2	Fig. 1 from Dal-Pra et al., 2011

Phenotype of all Fish created by or utilizing MO1-foxa2

Phenotype	Fish	Conditions	Figures
floor plate undifferentiated, abnormal	WT + MO1-foxa2	standard conditions	Fig. 1 from Dal-Pra et al., 2011
post-vent region curved ventral, abnormal	WT + MO1-foxa2	standard conditions	Fig. 1 from Dal-Pra et al., 2011
pancreas development disrupted, abnormal	WT + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas decreased size, abnormal	WT + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
exocrine pancreas decreased size, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver development disrupted, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas development disrupted, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver decreased size, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver development disrupted, abnormal	med12^s432/+ + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas decreased size, abnormal	med12^s432/+ + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver decreased size, abnormal	med12^s432/+ + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas development disrupted, abnormal	med12^s432/+ + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas development disrupted, abnormal	med12^s432/s432 + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver development disrupted, abnormal	med12^s432/s432 + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas aplastic, abnormal	med12^s432/s432 + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver aplastic, abnormal	med12^s432/s432 + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
gut duplicated, abnormal	AB + MO1-foxa2 + MO3-sox17	standard conditions	Fig. 6 from Muto et al., 2011
pancreas duplicated, abnormal	AB + MO1-foxa2 + MO3-sox17	standard conditions	Fig. 6 from Muto et al., 2011
liver duplicated, abnormal	AB + MO1-foxa2 + MO3-sox17	standard conditions	Fig. 6 from Muto et al., 2011
axial chorda mesoderm decreased width, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 , Fig. 8 from Dal-Pra et al., 2011
notochord cell decreased size, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. S1 from Dal-Pra et al., 2011
notochord posterior region truncated, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S2 from Dal-Pra et al., 2011
somite fused with somite, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 from Dal-Pra et al., 2011
hypochord decreased length, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S2 from Dal-Pra et al., 2011
notochord cell mislocalised, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S1 from Dal-Pra et al., 2011
hypochord disorganized, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 8 , Fig. S2 from Dal-Pra et al., 2011
floor plate disorganized, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 8 , Fig. S2 from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 , Fig. 8 from Dal-Pra et al., 2011
floor plate cell elongated, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. S1 from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 from Dal-Pra et al., 2011
floor plate decreased length, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S2 from Dal-Pra et al., 2011
notochord disorganized, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 8 , Fig. S2 from Dal-Pra et al., 2011
intestine goblet cell agr2 expression decreased amount, abnormal	WT + MO1-foxa2 + MO3-hif1ab	standard conditions	Fig. 6 from Lai et al., 2016
goblet cell cell maturation disrupted, abnormal	WT + MO1-foxa2 + MO3-hif1ab	standard conditions	Fig. 6 from Lai et al., 2016
hypochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3	standard conditions	Fig. S2 from Dal-Pra et al., 2011
notochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3	standard conditions	Fig. S2 from Dal-Pra et al., 2011
floor plate aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3	standard conditions	Fig. S2 from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
hypochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
floor plate aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
notochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
liver development disrupted, abnormal	med12^s432/+; gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
exocrine pancreas decreased size, abnormal	med12^s432/+; gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas development disrupted, abnormal	med12^s432/+; gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver decreased size, abnormal	med12^s432/+; gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008

Citations