Morpholino

MO1-gli2a

ID
ZDB-MRPHLNO-050209-6
Name
MO1-gli2a
Previous Names
  • Gli2-MO (1)
  • MO1-gli2 (1)
  • zfgli2 MO
Target
Sequence
5' - GGATGATGTAAAGTTCGTCAGTTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gli2a
Expressed Gene Anatomy Figures
alcama Fig. 5 with image from Vanderlaan et al., 2005
egr2b Fig. 5 with image,  Fig. 10 with image from Vanderlaan et al., 2005
foxa Fig. 4 with image from Tyurina et al., 2005
foxa2 Fig. 4 with image from Tyurina et al., 2005
gli1 Fig. 10 with image from Vanderlaan et al., 2005
lhx3 Fig. 3 with image from Devine et al., 2009
myod1 Fig. 8 with image from Karlstrom et al., 2003
nkx2.1 Fig. 9 with image from Karlstrom et al., 2003
nkx2.2a Fig. 8 with image from Gates et al., 2010
Fig. 3 with image,  Fig. 5 with image from Devine et al., 2009
Fig. 5 with image from Vanderlaan et al., 2005
Fig. 8 with image from Karlstrom et al., 2003
ntn1a Fig. 5 with image from Vanderlaan et al., 2005
pomca Fig. 5 with image from Devine et al., 2009
prl Fig. 4 with image,  Fig. 5 with image from Devine et al., 2009
ptch2 Fig. 10 with image from Vanderlaan et al., 2005
Fig. 8 with image from Karlstrom et al., 2003
tshba Fig. 4 with image from Devine et al., 2009
Phenotype
Phenotype resulting from MO1-gli2a
Phenotype Fish Figures
adenohypophysis physical object quality, abnormal WT + MO1-gli2a Fig. 5 with image from Devine et al., 2009
adenohypophysis wholly anteriorized, abnormal WT + MO1-gli2a Fig. 3 with image from Devine et al., 2009
adenohypophysis morphogenesis process quality, abnormal WT + MO1-gli2a Fig. 3 with image,  Fig. 5 with image from Devine et al., 2009
adrenocorticotropic hormone secreting cell decreased amount, abnormal WT + MO1-gli2a Fig. 4 with image from Devine et al., 2009
corticotropin hormone secreting cell differentiation process quality, abnormal WT + MO1-gli2a Fig. 4 with image from Devine et al., 2009
somatotropin secreting cell decreased amount, abnormal WT + MO1-gli2a Fig. 4 with image from Devine et al., 2009
Phenotype of all Fish created by or utilizing MO1-gli2a
Phenotype Fish Conditions Figures
adenohypophysis morphogenesis process quality, abnormal WT + MO1-gli2a standard conditions Fig. 3 with image,  Fig. 5 with image from Devine et al., 2009
adenohypophysis wholly anteriorized, abnormal WT + MO1-gli2a standard conditions Fig. 3 with image from Devine et al., 2009
corticotropin hormone secreting cell differentiation process quality, abnormal WT + MO1-gli2a standard conditions Fig. 4 with image from Devine et al., 2009
adenohypophysis physical object quality, abnormal WT + MO1-gli2a standard conditions Fig. 5 with image from Devine et al., 2009
adrenocorticotropic hormone secreting cell decreased amount, abnormal WT + MO1-gli2a standard conditions Fig. 4 with image from Devine et al., 2009
somatotropin secreting cell decreased amount, abnormal WT + MO1-gli2a standard conditions Fig. 4 with image from Devine et al., 2009
pars anterior physical object quality, abnormal gli1ts269/ts269 + MO1-gli2a standard conditions Fig. 3 with image from Devine et al., 2009
prolactin secreting cell differentiation process quality, abnormal gli1ts269/ts269 + MO1-gli2a standard conditions Fig. 4 with image from Devine et al., 2009
thyroid-stimulating hormone-secreting cell differentiation process quality, abnormal gli1ts269/ts269 + MO1-gli2a standard conditions Fig. 4 with image from Devine et al., 2009
adenohypophysis morphogenesis process quality, abnormal gli1ts269/ts269 + MO1-gli2a standard conditions Fig. 3 with image from Devine et al., 2009
somatotropin secreting cell differentiation process quality, abnormal gli1ts269/ts269 + MO1-gli2a standard conditions Fig. 4 with image from Devine et al., 2009
somatotropin secreting cell decreased amount, abnormal gli1ts269/ts269 + MO1-gli2a standard conditions Fig. 4 with image from Devine et al., 2009
thyroid stimulating hormone secreting cell decreased amount, abnormal gli1ts269/ts269 + MO1-gli2a standard conditions Fig. 4 with image from Devine et al., 2009
adrenocorticotropic hormone secreting cell decreased amount, abnormal gli1ts269/ts269 + MO1-gli2a standard conditions Fig. 4 with image from Devine et al., 2009
corticotropin hormone secreting cell differentiation process quality, abnormal gli1ts269/ts269 + MO1-gli2a standard conditions Fig. 4 with image from Devine et al., 2009
prolactin secreting cell decreased amount, abnormal gli1ts269/ts269 + MO1-gli2a standard conditions Fig. 4 with image from Devine et al., 2009
corticotropin hormone secreting cell differentiation process quality, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adenohypophysis wholly anteriorized, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 3 with image from Devine et al., 2009
somatotropin secreting cell decreased amount, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adrenocorticotropic hormone secreting cell decreased amount, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adenohypophysis morphogenesis process quality, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 3 with image from Devine et al., 2009
somatotropin secreting cell differentiation process quality, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
prolactin secreting cell increased amount, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
melanocyte stimulating hormone secreting cell decreased amount, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
cell proliferation in hindbrain occurrence, ameliorated cdh2r210/r210 + MO1-gli1 + MO1-gli2a standard conditions Fig. 5 from Chalasani et al., 2011
corticotropin hormone secreting cell differentiation process quality, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
prolactin secreting cell differentiation process quality, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adrenocorticotropic hormone secreting cell decreased amount, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
prolactin secreting cell decreased amount, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
somatotropin secreting cell decreased amount, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
melanocyte stimulating hormone secreting cell decreased amount, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
somatotropin secreting cell differentiation process quality, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
somatotropin secreting cell differentiation process quality, abnormal WT + MO1-gli1 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
somatotropin secreting cell decreased amount, abnormal WT + MO1-gli1 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.