Morpholino

MO1-gata1a

ID
ZDB-MRPHLNO-050208-10
Name
MO1-gata1a
Previous Names
  • gata1 MO (1)
  • MO(T)-gata1 (1)
  • MO1-gata1
  • Gata1 morpholino (1)
Target
Sequence
5' - CTGCAAGTGTAGTATTGAAGATGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
A translation blocking morpholino targeting gata1.
This morpholino sequence was reported with an additional nucleotide in Rhodes et al. 2005 and is correct as displayed here confirmed by author.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gata1a
Expressed Gene Anatomy Figures
alas2 Fig. 3 with image from Galloway et al., 2005
blvra Fig. 6 from Holowiecki et al., 2017
blvrb Fig. 6 from Holowiecki et al., 2017
bmp4 Fig. 2 with image from Vermot et al., 2009
cahz Fig. 2 from Galloway et al., 2008
Fig. 3 with image from Galloway et al., 2005
dre-mir-21-1 Fig. 3 from Banjo et al., 2013
drl Fig. 6 with image from Pimtong et al., 2014
drll.1 Fig. 6 with image from Pimtong et al., 2014
drll.2 Fig. 6 with image from Pimtong et al., 2014
drll.3 Fig. 6 with image from Pimtong et al., 2014
edn1 Fig. 2 with image from Vermot et al., 2009
foxc1a Fig. 6 with image from Chen et al., 2017
foxc1b Fig. 6 with image from Chen et al., 2017
gata1a Fig. 2 from Galloway et al., 2008
Fig. 3 with image from Galloway et al., 2005
Fig. 4 from Rhodes et al., 2005
glcci1a Fig. 4 with image from Galloway et al., 2005
hbae1.1 Fig. 5 from Li et al., 2020
Fig. 4 from Rhodes et al., 2005
hbae3 Fig. 5 with image from Glenn et al., 2014
hbbe1.1 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Galloway et al., 2005
hbbe3 Fig. 2 from Galloway et al., 2008
her9 Fig. 4 with image from Chen et al., 2017
hey1 Fig. 4 with image from Chen et al., 2017
hey2 Fig. 4 with image from Chen et al., 2017
ikzf1 Fig. 2 from Galloway et al., 2008
Fig. 1 with image from Galloway et al., 2005
irf8 Fig. S1 with image from Glenn et al., 2014
jag1b Fig. 4 with image from Chen et al., 2017
klf2a Fig. 2 with image from Vermot et al., 2009
klf17 Fig. 4 with image from Galloway et al., 2005
krcp Fig. 4 with image from Galloway et al., 2005
lcp1 Fig. 6 with image from Pimtong et al., 2014
Fig. 6 from Clatworthy et al., 2009
Fig. 7 with image from Yeh et al., 2008
Fig. 1 with image,  Fig. S1 with image from Galloway et al., 2005
Fig. 4 from Rhodes et al., 2005
lmo2 Fig. 5 from Rhodes et al., 2005
lyz Fig. S1 with image from Glenn et al., 2014
mpx Fig. 5 with image,  Fig. 6 with image,  Fig. S2 with image from Glenn et al., 2014
Fig. 7 with image from Yeh et al., 2008
Fig. 1 with image,  Fig. S1 with image from Galloway et al., 2005
Fig. 4 from Rhodes et al., 2005
myb Fig. 1 with image from Galloway et al., 2005
notch1b Fig. 4 with image from Chen et al., 2017
Fig. 2 with image from Vermot et al., 2009
nrg1 Fig. 2 with image from Vermot et al., 2009
runx1 Fig. 1 with image from Galloway et al., 2005
Fig. 5 from Rhodes et al., 2005
slc4a1a Fig. 6 with image from Pimtong et al., 2014
smchd1 Fig. 4 with image from Galloway et al., 2005
spi1b Fig. 2 with image,  Fig. 4 with image from Takeuchi et al., 2015
Fig. 6 with image from Glenn et al., 2014
Fig. 6 with image from Pimtong et al., 2014
Fig. 3 from Sumanas et al., 2008
Fig. 7 with image from Yeh et al., 2008
Fig. 1 with image,  Fig. 2 with image from Galloway et al., 2005
Fig. 4 from Rhodes et al., 2005
tal1 Fig. 5 from Rhodes et al., 2005
vegfc Fig. 8 with image from Helker et al., 2013
znfl2a Fig. S3 from Galloway et al., 2008
Phenotype
Phenotype resulting from MO1-gata1a
Phenotype Fish Figures
atrial endocardium endothelial cell increased amount, abnormal ubs10Tg + MO1-gata1a Fig. 2 with image from Heckel et al., 2015
atrioventricular canal ab2-fn labeling increased amount, abnormal ubs10Tg + MO1-gata1a Fig. 5 with image from Steed et al., 2016
atrioventricular canal blood circulation process quality, abnormal sd2Tg + MO1-gata1a Fig. 2 with image from Heckel et al., 2015
atrioventricular valve morphology, abnormal WT + MO1-gata1a Fig. 2 with image from Vermot et al., 2009
blood decreased viscosity, abnormal WT + MO1-gata1a Fig. 2 with image from Vermot et al., 2009
blood circulating cell absent, abnormal WT + MO1-gata1a Fig. 2 with image from Vermot et al., 2009
blood island spi1b expression mislocalised, abnormal AB + MO1-gata1a Fig. 2 with image from Takeuchi et al., 2015
cardiac ventricle EGFP expression increased amount, abnormal ig11Tg + MO1-gata1a Fig. 2 with image from Heckel et al., 2015
caudal hematopoietic tissue blvrb expression increased amount, abnormal TL + MO1-gata1a Fig. 6 from Holowiecki et al., 2017
caudal hematopoietic tissue blvra expression increased amount, abnormal TL + MO1-gata1a Fig. 6 from Holowiecki et al., 2017
common cardinal vein blood vessel endothelial cell decreased amount, abnormal WT + MO1-gata1a Fig. 8 with image from Helker et al., 2013
dorsal aorta foxc1b expression decreased amount, abnormal hu10049Tg + MO1-gata1a Fig. 6 with image from Chen et al., 2017
dorsal aorta anatomical region mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-gata1a Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-gata1a Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal s843Tg; uto5Tg + MO1-gata1a Fig. 2 with image from Chen et al., 2017
endothelial cell notch1b expression decreased amount, abnormal s843Tg + MO1-gata1a Fig. 4 with image from Chen et al., 2017
endothelial cell hey2 expression decreased amount, abnormal s843Tg + MO1-gata1a Fig. 4 with image from Chen et al., 2017
endothelial cell hey1 expression decreased amount, abnormal s843Tg + MO1-gata1a Fig. 4 with image from Chen et al., 2017
endothelial cell jag1b expression decreased amount, abnormal s843Tg + MO1-gata1a Fig. 4 with image from Chen et al., 2017
endothelial cell her9 expression decreased amount, abnormal s843Tg + MO1-gata1a Fig. 4 with image from Chen et al., 2017
erythroid lineage cell slc4a1a expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
heart blvrb expression increased amount, abnormal TL + MO1-gata1a Fig. 6 from Holowiecki et al., 2017
hematopoietic system drl expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drll.3 expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drll.1 expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drll.2 expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm blvrb expression absent, abnormal TL + MO1-gata1a Fig. 6 from Holowiecki et al., 2017
intermediate cell mass of mesoderm drl expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drll.3 expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm blvra expression decreased amount, abnormal TL + MO1-gata1a Fig. 6 from Holowiecki et al., 2017
intermediate cell mass of mesoderm drll.2 expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drll.1 expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm slc4a1a expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm spi1b expression increased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm spi1b expression mislocalised, abnormal AB + MO1-gata1a Fig. 4 with image from Takeuchi et al., 2015
liver blvrb expression increased amount, abnormal TL + MO1-gata1a Fig. 6 from Holowiecki et al., 2017
monocyte lcp1 expression increased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
myeloid cell increased amount, abnormal WT + MO1-gata1a Fig. S6 with image from Hall et al., 2007
nucleate erythrocyte absent, abnormal WT + MO1-gata1a Fig. 2 with image from Chen et al., 2017
Fig. 8 with image from Helker et al., 2013
nucleate erythrocyte hbae1.1 expression increased distribution, abnormal TU + MO1-gata1a Fig. 5 from Li et al., 2020
nucleate erythrocyte development disrupted, abnormal WT + MO1-gata1a Fig. 8 with image from Helker et al., 2013
whole organism foxc1b expression decreased amount, abnormal WT + MO1-gata1a Fig. 6 with image from Chen et al., 2017
whole organism foxc1a expression decreased amount, abnormal WT + MO1-gata1a Fig. 6 with image from Chen et al., 2017
Phenotype of all Fish created by or utilizing MO1-gata1a
Phenotype Fish Conditions Figures
intermediate cell mass of mesoderm drll.3 expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drl expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
erythroid lineage cell slc4a1a expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drll.3 expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drll.2 expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
blood island spi1b expression mislocalised, abnormal AB + MO1-gata1a standard conditions Fig. 2 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm drll.1 expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drll.2 expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm spi1b expression mislocalised, abnormal AB + MO1-gata1a standard conditions Fig. 4 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm spi1b expression increased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm slc4a1a expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drl expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drll.1 expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
monocyte lcp1 expression increased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
caudal hematopoietic tissue blvra expression increased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
liver blvrb expression increased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
intermediate cell mass of mesoderm blvra expression decreased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
intermediate cell mass of mesoderm blvrb expression absent, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
caudal hematopoietic tissue blvrb expression increased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
heart blvrb expression increased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
nucleate erythrocyte hbae1.1 expression increased distribution, abnormal TU + MO1-gata1a control Fig. 5 from Li et al., 2020
blood circulating cell absent, abnormal WT + MO1-gata1a standard conditions Fig. 2 with image from Vermot et al., 2009
atrioventricular valve morphology, abnormal WT + MO1-gata1a standard conditions Fig. 2 with image from Vermot et al., 2009
whole organism foxc1b expression decreased amount, abnormal WT + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
nucleate erythrocyte development disrupted, abnormal WT + MO1-gata1a standard conditions Fig. 8 with image from Helker et al., 2013
nucleate erythrocyte absent, abnormal WT + MO1-gata1a standard conditions Fig. 8 with image from Helker et al., 2013
common cardinal vein blood vessel endothelial cell decreased amount, abnormal WT + MO1-gata1a standard conditions Fig. 8 with image from Helker et al., 2013
myeloid cell increased amount, abnormal WT + MO1-gata1a standard conditions Fig. S6 with image from Hall et al., 2007
blood decreased viscosity, abnormal WT + MO1-gata1a standard conditions Fig. 2 with image from Vermot et al., 2009
whole organism foxc1a expression decreased amount, abnormal WT + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
dorsal aorta foxc1b expression decreased amount, abnormal hu10049Tg + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
whole organism foxc1b expression decreased amount, abnormal hu10049Tg + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
cardiac ventricle EGFP expression increased amount, abnormal ig11Tg + MO1-gata1a control Fig. 2 with image from Heckel et al., 2015
endothelial cell jag1b expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
endothelial cell hey1 expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
endothelial cell hey2 expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
endothelial cell notch1b expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
endothelial cell her9 expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
atrioventricular canal blood circulation process quality, abnormal sd2Tg + MO1-gata1a control Fig. 2 with image from Heckel et al., 2015
atrioventricular canal ab2-fn labeling increased amount, abnormal ubs10Tg + MO1-gata1a control Fig. 5 with image from Steed et al., 2016
atrial endocardium endothelial cell increased amount, abnormal ubs10Tg + MO1-gata1a control Fig. 2 with image from Heckel et al., 2015
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-gata1a control Fig. 2 with image from Chen et al., 2017
nucleate erythrocyte absent, abnormal s843Tg; uto5Tg + MO1-gata1a control Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal s843Tg; uto5Tg + MO1-gata1a control Fig. 2 with image from Chen et al., 2017
dorsal aorta anatomical region mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-gata1a control Fig. 2 with image from Chen et al., 2017
intermediate cell mass of mesoderm spi1b expression position, ameliorated kdm1ait627/it627 + MO1-gata1a (AB) standard conditions Fig. 4 with image from Takeuchi et al., 2015
blood island spi1b expression position, ameliorated kdm1ait627/it627 + MO1-gata1a (AB) standard conditions Fig. 2 with image from Takeuchi et al., 2015
nucleate erythrocyte hbae1.1 expression spatial pattern, ameliorated p2ry12sih3/sih3 + MO1-gata1a (TU) control Fig. 5 from Li et al., 2020
intermediate cell mass of mesoderm spi1b expression mislocalised, abnormal AB + MO1-etsrp + MO1-gata1a standard conditions Fig. 4 with image from Takeuchi et al., 2015
blood decreased viscosity, abnormal WT + MO1-gata1a + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
blood circulating cell absent, abnormal WT + MO1-gata1a + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
atrioventricular valve morphology, abnormal WT + MO1-gata1a + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
intermediate cell mass of mesoderm spi1b expression position, ameliorated kdm1ait627/it627 + MO1-etsrp + MO1-gata1a (AB) standard conditions Fig. 4 with image from Takeuchi et al., 2015
atrioventricular canal EGFP expression decreased amount, abnormal ig11Tg + MO1-gata1a + MO1-gata2a control Fig. 2 with image from Heckel et al., 2015
caudal vein plexus size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-gata1a standard conditions Figure 4 with image from Li et al., 2021
dorsal aorta foxc1b expression amount, ameliorated hu10049Tg; kca3Tg + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
whole organism foxc1b expression amount, ameliorated hu10049Tg; kca3Tg + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.