FIGURE

Fig. S2

ID

ZDB-FIG-070918-63

Publication

Walker et al., 2006 - Zebrafish furin mutants reveal intricacies in regulating Endothelin1 signaling in craniofacial patterning

Other Figures

All Figure Page

Back to All Figure Page

Fig. S2

Loss of maternal furinA does not enhance jaw defects in furinA mutants. (A) Temporal expression profiles of furinA and edn1 were determined by RT-PCR. The zebrafish ornithinedecarboxylase (odc) gene was used as an internal PCR control. The following primer pairs were used: furinA, 5′AGCGGAGGCGTCAATGA3′/5′TGAGCACGGCCACAATGGCAG3′ (1138 bp); edn1, 5′CCTGAAATGCATGACGTGTG3′/5′AATACGGGACTTGCATACTACA3′ (659 bp); and odc, 52ACACTATGACGGCTTGCACCG3′/5′CCCACTGACTGCACGATCTGG3′ (309 bp). (B) Loss of maternal furinA alone yields only phenotypically wild-type larvae. Loss of both maternal and zygotic furinA does not enhance joint loss phenotype over loss of zygotic furinA alone. M, maternal; Z, zygotic.

Expression Data

Expression Detail

Antibody Labeling

Phenotype Data

Phenotype Detail

Acknowledgments

This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image.

Reprinted from Developmental Biology, 295(1), Walker, M.B., Miller, C.T., Talbot, J.C., Stock, D.W., and Kimmel, C.B., Zebrafish furin mutants reveal intricacies in regulating Endothelin1 signaling in craniofacial patterning, 194-205, Copyright (2006) with permission from Elsevier. Full text @ Dev. Biol.