CRISPR

CRISPR2-tfec

ID
ZDB-CRISPR-171108-1
Name
CRISPR2-tfec
Previous Names
None
Target
Sequence
5' - GACGATCCTCAAGGCCTCGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ba6 tfec
vc58 tfec
vc60 tfec
vc64 tfec
Expression
Gene expression in Wild Types + CRISPR2-tfec
No data available
Phenotype
Phenotype resulting from CRISPR2-tfec
No data available
Phenotype of all Fish created by or utilizing CRISPR2-tfec
Phenotype Fish Conditions Figures
dorsal larval melanophore stripe iridophore tfec expression decreased amount, abnormal tfecba6/ba6 standard conditions Fig 5 with image from Petratou et al., 2021
trunk ventral region tfec expression decreased amount, abnormal tfecba6/ba6 standard conditions Fig. 3 with image from Petratou et al., 2018
eye iridophore absent, abnormal tfecba6/ba6 standard conditions Fig 3 with image from Petratou et al., 2021
iridoblast ltk expression absent, abnormal tfecba6/ba6 standard conditions Fig 5 with image from Petratou et al., 2021
eye tfec expression decreased amount, abnormal tfecba6/ba6 standard conditions Fig. 3 with image from Petratou et al., 2018
ventral larval melanophore stripe iridophore absent, abnormal tfecba6/ba6 standard conditions Fig 3 with image from Petratou et al., 2021
iridoblast ltk expression absent, abnormal tfecba6/ba6 standard conditions Fig. 3 with image from Petratou et al., 2018
iridophore pnp4a expression absent, abnormal tfecba6/ba6 standard conditions Fig. 4 with image from Petratou et al., 2018
iridophore pnp4a expression absent, abnormal tfecba6/ba6 standard conditions Fig 5 with image from Petratou et al., 2021
trunk dorsal region tfec expression decreased distribution, abnormal tfecba6/ba6 standard conditions Fig. 3 with image from Petratou et al., 2018
melanoblast mitfa expression absent, abnormal tfecba6/ba6 standard conditions Fig 5 with image from Petratou et al., 2021
iridoblast tfec expression decreased amount, abnormal tfecba6/ba6 standard conditions Fig 5 with image from Petratou et al., 2021
trunk medial region pnp4a expression decreased amount, abnormal tfecba6/ba6 standard conditions Fig. 4 with image from Petratou et al., 2018
iridoblast pnp4a expression decreased amount, abnormal tfecba6/ba6 standard conditions Fig 5 with image from Petratou et al., 2021
melanoblast mitfa expression decreased amount, abnormal tfecba6/ba6 standard conditions Fig 5 with image from Petratou et al., 2021
iridophore ltk expression absent, abnormal tfecba6/ba6 standard conditions Fig. 3 with image from Petratou et al., 2018
trunk dorsal region pnp4a expression decreased amount, abnormal tfecba6/ba6 standard conditions Fig. 4 with image from Petratou et al., 2018
dorsal larval melanophore stripe iridophore absent, abnormal tfecba6/ba6 standard conditions Fig 3 with image from Petratou et al., 2021
trunk dorsal region pnp4a expression decreased distribution, abnormal tfecba6/ba6 standard conditions Fig. 4 with image from Petratou et al., 2018
retinal pigmented epithelium color, abnormal tfecvc60/vc60 standard conditions Fig. S1 with image from Sinagoga et al., 2020
eye decreased size, abnormal tfecvc60/vc60 standard conditions Fig. S1 with image from Sinagoga et al., 2020
yolk larval melanophore stripe iridophore absent, abnormal tfecvc60/vc60 standard conditions Fig 3 with image from Petratou et al., 2021
xanthoblast aox5 expression decreased distribution, abnormal tfecvc60/vc60 standard conditions Fig 5 with image from Petratou et al., 2021
eye iridophore absent, abnormal tfecvc60/vc60 standard conditions Fig 3 with image from Petratou et al., 2021
head iridophore absent, abnormal tfecvc60/vc60 standard conditions Fig 3 with image from Petratou et al., 2021
dorsal larval melanophore stripe iridophore absent, abnormal tfecvc60/vc60 standard conditions Fig 3 with image from Petratou et al., 2021
xanthoblast gch2 expression decreased distribution, abnormal tfecvc60/vc60 standard conditions Fig 5 with image from Petratou et al., 2021
ventral larval melanophore stripe iridophore absent, abnormal tfecvc60/vc60 standard conditions Fig 3 with image from Petratou et al., 2021
trunk dorsal region tfec expression absent, abnormal foxd3zdf10/zdf10; tfecvc60/vc60 standard conditions Fig 7 with image from Petratou et al., 2021
retinal pigmented epithelium eye pigmentation decreased magnitude, abnormal mitfaw2/w2; tfecvc60/+ standard conditions Fig. 2 with image from Sinagoga et al., 2020
retinal pigmented epithelium eye pigmentation decreased magnitude, exacerbated mitfaw2/w2; tfecvc60/vc60 standard conditions Fig. 2 with image from Sinagoga et al., 2020
optic fissure basement membrane increased amount, abnormal mitfaw2/w2; tfecvc60/vc60 standard conditions Fig. 1 with image from Sinagoga et al., 2020
optic fissure open, abnormal mitfaw2/w2; tfecvc60/vc60 standard conditions Fig. 1 with image from Sinagoga et al., 2020
retinal pigmented epithelium color, abnormal mitfaw2/w2; tfecvc60/vc60 standard conditions Fig. 2 with image from Sinagoga et al., 2020
periocular mesenchyme cranial neural crest cell decreased amount, abnormal mitfaw2/w2; tfecvc60/vc60; w47Tg standard conditions Fig. 2 with image from Sinagoga et al., 2020
optic cup migratory neural crest cell decreased amount, abnormal mitfaw2/w2; tfecvc60/vc60; w47Tg standard conditions Fig. 2 with image from Sinagoga et al., 2020
neural tube migratory neural crest cell mislocalised, abnormal mitfaw2/w2; tfecvc60/vc60; w47Tg standard conditions Fig. 2 with image from Sinagoga et al., 2020
Citations