TALEN

TALEN1-nr2f1b

ID

ZDB-TALEN-180628-1

Name

TALEN1-nr2f1b

Previous Names

None

Target

nr2f1b (1)

Target Sequence 1

5' - TGGCAGCGGTGGATGATCAG - 3'

Target Sequence 2

5' - TGCCGGTGCTGGAGGTGCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
el523	nr2f1b

Expression

Gene expression in Wild Types + TALEN1-nr2f1b

No data available

Phenotype

Phenotype resulting from TALEN1-nr2f1b

No data available

Phenotype of all Fish created by or utilizing TALEN1-nr2f1b

Phenotype	Fish	Conditions	Figures
mandibular arch skeleton malformed, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 3 from Okeke et al., 2022
ceratobranchial cartilage absent, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 3 from Okeke et al., 2022
hyomandibula malformed, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611	standard conditions	Fig. 3 from Okeke et al., 2022
pharyngeal arch 2 hand2 expression increased distribution, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pterygoid process increased thickness, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
retroarticular increased amount, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
mandibular arch skeleton msx1a expression increased distribution, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
pharyngeal arch 1 ednraa expression decreased amount, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 5 from Barske et al., 2018
maxilla msx1a expression increased amount, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
maxilla bony projection sox9a expression mislocalised, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
pharyngeal arch 2 ednraa expression decreased amount, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 5 from Barske et al., 2018
pharyngeal arch 1 hand2 expression increased distribution, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 , Fig. 6 from Barske et al., 2018
palatoquadrate arch increased size, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
maxilla bony projection sox9a expression increased amount, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
maxilla msx1a expression increased distribution, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
maxilla sox9a expression increased distribution, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
entopterygoid osteoblast decreased amount, abnormal	nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611; el10Tg (TU)	standard conditions	Fig. 2 from Barske et al., 2018
mandibular arch skeleton dlx6a expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
mandibular arch skeleton dlx3b expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
pterygoid process increased thickness, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
mandibular arch skeleton dlx5a expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
maxilla nkx3-2 expression increased amount, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
maxilla dlx6a expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
pharyngeal arch 2 dlx5a expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
maxilla dlx6a expression increased amount, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
pharyngeal arch 1 nkx3-2 expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
palatoquadrate arch increased thickness, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
maxilla dlx3b expression increased amount, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
dorsal hyoid arch decreased size, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
maxilla dlx5a expression increased amount, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 , Fig. 6 from Barske et al., 2018
pharyngeal arch 1 dlx5a expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
maxilla dlx3b expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
maxilla dlx5a expression increased distribution, abnormal	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 4 from Barske et al., 2018
palatoquadrate arch increased size, exacerbated	nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018
pharyngeal arch 2 hand2 expression spatial pattern, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 1 hand2 expression spatial pattern, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/+; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
Meckel's cartilage morphology, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
maxilla dlx5a expression increased amount, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
maxilla dlx6a expression increased amount, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 1 dlx5a expression spatial pattern, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 2 dlx6a expression increased distribution, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 1 dlx6a expression spatial pattern, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
quadrate-anguloarticular joint morphology, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 2 dlx5a expression increased distribution, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/+; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
Meckel's cartilage morphology, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 2 prrx1b expression increased distribution, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 1 prrx1b expression spatial pattern, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 1 jag1b expression spatial pattern, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
pharyngeal arch 2 jag1b expression increased distribution, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
quadrate-anguloarticular joint morphology, ameliorated	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
palatoquadrate arch increased size, abnormal	edn1^{tf216b/tf216b}; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 6 from Barske et al., 2018
neural crest cell migration decreased occurrence, abnormal	nr2f1a^el512/el512; nr2f1b^el523/el523; nr2f2^el506/el506; nr2f5^el611/el611 (TU)	standard conditions	Fig. 2 from Barske et al., 2018

Citations