Morpholino

MO1-klhdc1

ID
ZDB-MRPHLNO-230516-1
Name
MO1-klhdc1
Previous Names
None
Target
Sequence
5' - ACGCACACACCTGCAAAGGAGGAGGAGAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-klhdc1
Expressed Gene Anatomy Figures
fgf8a Fig. 4 with image from Jung et al., 2021
gli1 Fig. 5 with image from Jung et al., 2021
nkx2.2a Fig. 6 with image from Jung et al., 2021
olig2 Fig. 6 with image from Jung et al., 2021
otx2b Fig. 6 with image from Jung et al., 2021
pax2a Fig. 4 with image from Jung et al., 2021
rx3 Fig. 4 with image from Jung et al., 2021
shha Fig. 5 with image from Jung et al., 2021
shhb Fig. 5 with image from Jung et al., 2021
th Fig. 6 with image from Jung et al., 2021
wnt1 Fig. 4 with image from Jung et al., 2021
wnt8b Fig. 4 with image from Jung et al., 2021
zic2b Fig. 6 with image from Jung et al., 2021
Phenotype
Phenotype resulting from MO1-klhdc1
Phenotype Fish Figures
diencephalon dopaminergic neuron differentiation decreased process quality, abnormal WT + MO1-klhdc1 Fig. 6 with image from Jung et al., 2021
diencephalon ventral region th expression absent, abnormal WT + MO1-klhdc1 Fig. 6 with image from Jung et al., 2021
diencephalon ventral region nkx2.2a expression decreased amount, abnormal WT + MO1-klhdc1 Fig. 6 with image from Jung et al., 2021
diencephalon ventral region shhb expression decreased amount, abnormal WT + MO1-klhdc1 Fig. 5 with image from Jung et al., 2021
diencephalon ventral region olig2 expression decreased amount, abnormal WT + MO1-klhdc1 Fig. 6 with image from Jung et al., 2021
forebrain neural keel rx3 expression decreased amount, abnormal WT + MO1-klhdc1 Fig. 4 with image from Jung et al., 2021
midbrain otx2b expression decreased amount, abnormal WT + MO1-klhdc1 Fig. 6 with image from Jung et al., 2021
midbrain decreased volume, abnormal WT + MO1-klhdc1 Fig. 3 with image from Jung et al., 2021
midbrain decreased width, abnormal WT + MO1-klhdc1 Fig. 3 with image from Jung et al., 2021
midbrain development decreased process quality, abnormal WT + MO1-klhdc1 Fig. 3 with image from Jung et al., 2021
midbrain hindbrain boundary neural keel pax2a expression decreased amount, abnormal WT + MO1-klhdc1 Fig. 4 with image from Jung et al., 2021
midbrain hindbrain boundary neural keel wnt8b expression decreased amount, abnormal WT + MO1-klhdc1 Fig. 4 with image from Jung et al., 2021
midbrain hindbrain boundary neural keel fgf8a expression decreased amount, abnormal WT + MO1-klhdc1 Fig. 4 with image from Jung et al., 2021
neural crest midbrain zic2b expression decreased amount, abnormal WT + MO1-klhdc1 Fig. 6 with image from Jung et al., 2021
thalamus shha expression decreased amount, abnormal WT + MO1-klhdc1 Fig. 5 with image from Jung et al., 2021
Phenotype of all Fish created by or utilizing MO1-klhdc1
Phenotype Fish Conditions Figures
midbrain hindbrain boundary neural keel wnt8b expression decreased amount, abnormal WT + MO1-klhdc1 standard conditions Fig. 4 with image from Jung et al., 2021
diencephalon ventral region olig2 expression decreased amount, abnormal WT + MO1-klhdc1 standard conditions Fig. 6 with image from Jung et al., 2021
neural crest midbrain zic2b expression decreased amount, abnormal WT + MO1-klhdc1 standard conditions Fig. 6 with image from Jung et al., 2021
midbrain development decreased process quality, abnormal WT + MO1-klhdc1 standard conditions Fig. 3 with image from Jung et al., 2021
midbrain otx2b expression decreased amount, abnormal WT + MO1-klhdc1 standard conditions Fig. 6 with image from Jung et al., 2021
midbrain decreased width, abnormal WT + MO1-klhdc1 standard conditions Fig. 3 with image from Jung et al., 2021
forebrain neural keel rx3 expression decreased amount, abnormal WT + MO1-klhdc1 standard conditions Fig. 4 with image from Jung et al., 2021
diencephalon ventral region th expression absent, abnormal WT + MO1-klhdc1 standard conditions Fig. 6 with image from Jung et al., 2021
diencephalon ventral region nkx2.2a expression decreased amount, abnormal WT + MO1-klhdc1 standard conditions Fig. 6 with image from Jung et al., 2021
midbrain hindbrain boundary neural keel pax2a expression decreased amount, abnormal WT + MO1-klhdc1 standard conditions Fig. 4 with image from Jung et al., 2021
midbrain decreased volume, abnormal WT + MO1-klhdc1 standard conditions Fig. 3 with image from Jung et al., 2021
diencephalon dopaminergic neuron differentiation decreased process quality, abnormal WT + MO1-klhdc1 standard conditions Fig. 6 with image from Jung et al., 2021
diencephalon ventral region shhb expression decreased amount, abnormal WT + MO1-klhdc1 standard conditions Fig. 5 with image from Jung et al., 2021
thalamus shha expression decreased amount, abnormal WT + MO1-klhdc1 standard conditions Fig. 5 with image from Jung et al., 2021
midbrain hindbrain boundary neural keel fgf8a expression decreased amount, abnormal WT + MO1-klhdc1 standard conditions Fig. 4 with image from Jung et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.