Morpholino

MO2-kif15

ID

ZDB-MRPHLNO-221117-2

Name

MO2-kif15

Previous Names

None

Target

Sequence

5' - ATGTATTAAAAACCTCACCTGGCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-kif15

No data available

Phenotype

Phenotype resulting from MO2-kif15

Phenotype	Fish	Figures
inner ear hair cell decreased amount, abnormal	s356tTg + MO2-kif15	FIGURE 3 from Zheng et al., 2022
locomotory behavior process quality, abnormal	AB + MO2-kif15	FIGURE 5 from Zheng et al., 2022
otolith decreased amount, abnormal	AB + MO2-kif15	FIGURE 2 from Zheng et al., 2022
otolith increased amount, abnormal	AB + MO2-kif15	FIGURE 2 from Zheng et al., 2022
otolith mislocalised, abnormal	AB + MO2-kif15	FIGURE 2 from Zheng et al., 2022
otolith morphology, abnormal	AB + MO2-kif15	FIGURE 2 from Zheng et al., 2022
posterior lateral line development disrupted, abnormal	zf106Tg + MO2-kif15	FIGURE 4 from Zheng et al., 2022
posterior lateral line neuromast decreased amount, abnormal	zf106Tg + MO2-kif15	FIGURE 4 from Zheng et al., 2022
saccule hair cell decreased amount, abnormal	s356tTg + MO2-kif15	FIGURE 3 from Zheng et al., 2022
semicircular canal morphology, abnormal	AB + MO2-kif15	FIGURE 1 from Zheng et al., 2022
semicircular canal morphogenesis disrupted, abnormal	AB + MO2-kif15	FIGURE 1 from Zheng et al., 2022
utricle hair cell decreased amount, abnormal	s356tTg + MO2-kif15	FIGURE 3 from Zheng et al., 2022

Phenotype of all Fish created by or utilizing MO2-kif15

Phenotype	Fish	Conditions	Figures
semicircular canal morphogenesis disrupted, abnormal	AB + MO2-kif15	standard conditions	FIGURE 1 from Zheng et al., 2022
otolith increased amount, abnormal	AB + MO2-kif15	standard conditions	FIGURE 2 from Zheng et al., 2022
locomotory behavior process quality, abnormal	AB + MO2-kif15	standard conditions	FIGURE 5 from Zheng et al., 2022
otolith decreased amount, abnormal	AB + MO2-kif15	standard conditions	FIGURE 2 from Zheng et al., 2022
otolith mislocalised, abnormal	AB + MO2-kif15	standard conditions	FIGURE 2 from Zheng et al., 2022
semicircular canal morphology, abnormal	AB + MO2-kif15	standard conditions	FIGURE 1 from Zheng et al., 2022
otolith morphology, abnormal	AB + MO2-kif15	standard conditions	FIGURE 2 from Zheng et al., 2022
inner ear hair cell decreased amount, abnormal	s356tTg + MO2-kif15	standard conditions	FIGURE 3 from Zheng et al., 2022
saccule hair cell decreased amount, abnormal	s356tTg + MO2-kif15	standard conditions	FIGURE 3 from Zheng et al., 2022
utricle hair cell decreased amount, abnormal	s356tTg + MO2-kif15	standard conditions	FIGURE 3 from Zheng et al., 2022
posterior lateral line neuromast decreased amount, abnormal	zf106Tg + MO2-kif15	standard conditions	FIGURE 4 from Zheng et al., 2022
posterior lateral line development disrupted, abnormal	zf106Tg + MO2-kif15	standard conditions	FIGURE 4 from Zheng et al., 2022

Citations