Morpholino

MO1-ccn1l2

ID

ZDB-MRPHLNO-200304-4

Name

MO1-ccn1l2

Previous Names

None

Target

ccn1l2 (1)

Sequence

5' - CTCCGCTGACACACACACACAGGAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ccn1l2

Expressed Gene	Anatomy	Figures
fli1	trunk whole organism anterior-posterior axis	Figure 1 from Park et al., 2019
flt4	dorsal aorta posterior cardinal vein	Figure 1 figure supplement 1 from Park et al., 2019
notch1b	dorsal aorta intersegmental vessel spinal cord	Figure 1 figure supplement 1 from Park et al., 2019

Phenotype

Phenotype resulting from MO1-ccn1l2

Phenotype	Fish	Figures
cranial vasculature sprouting angiogenesis process quality, abnormal	s843Tg + MO1-ccn1l2	Figure 1 from Park et al., 2019
dorsal aorta notch1b expression decreased amount, abnormal	AB + MO1-ccn1l2	Figure 1 figure supplement 1 from Park et al., 2019
dorsal aorta flt4 expression mislocalised, abnormal	AB + MO1-ccn1l2	Figure 1 figure supplement 1 from Park et al., 2019
dorsal longitudinal anastomotic vessel morphology, abnormal	s843Tg + MO1-ccn1l2	Figure 1 from Park et al., 2019
head decreased size, abnormal	s843Tg + MO1-ccn1l2	Figure 1 from Park et al., 2019
intersegmental vessel branchiness, abnormal	s843Tg + MO1-ccn1l2	Figure 1 from Park et al., 2019
intersegmental vessel notch1b expression decreased amount, abnormal	AB + MO1-ccn1l2	Figure 1 figure supplement 1 from Park et al., 2019
intersegmental vessel detached from dorsal longitudinal anastomotic vessel, abnormal	s843Tg + MO1-ccn1l2	Figure 1 from Park et al., 2019
intersegmental vessel morphology, abnormal	s843Tg + MO1-ccn1l2	Figure 1 from Park et al., 2019
pericardial region edematous, abnormal	s843Tg + MO1-ccn1l2	Figure 1 from Park et al., 2019
trunk bent, abnormal	s843Tg + MO1-ccn1l2	Figure 1 from Park et al., 2019
trunk fli1 expression spatial pattern, abnormal	AB + MO1-ccn1l2	Figure 1 from Park et al., 2019
trunk vasculature sprouting angiogenesis process quality, abnormal	s843Tg + MO1-ccn1l2	Figure 1 from Park et al., 2019
whole organism anterior-posterior axis fli1 expression increased amount, abnormal	AB + MO1-ccn1l2	Figure 1 from Park et al., 2019
whole organism anterior-posterior axis fli1 expression mislocalised, abnormal	AB + MO1-ccn1l2	Figure 1 from Park et al., 2019

Phenotype of all Fish created by or utilizing MO1-ccn1l2

Phenotype	Fish	Conditions	Figures
dorsal aorta flt4 expression mislocalised, abnormal	AB + MO1-ccn1l2	standard conditions	Figure 1 figure supplement 1 from Park et al., 2019
intersegmental vessel notch1b expression decreased amount, abnormal	AB + MO1-ccn1l2	standard conditions	Figure 1 figure supplement 1 from Park et al., 2019
whole organism anterior-posterior axis fli1 expression increased amount, abnormal	AB + MO1-ccn1l2	standard conditions	Figure 1 from Park et al., 2019
whole organism anterior-posterior axis fli1 expression mislocalised, abnormal	AB + MO1-ccn1l2	standard conditions	Figure 1 from Park et al., 2019
trunk fli1 expression spatial pattern, abnormal	AB + MO1-ccn1l2	standard conditions	Figure 1 from Park et al., 2019
dorsal aorta notch1b expression decreased amount, abnormal	AB + MO1-ccn1l2	standard conditions	Figure 1 figure supplement 1 from Park et al., 2019
trunk vasculature sprouting angiogenesis process quality, abnormal	s843Tg + MO1-ccn1l2	standard conditions	Figure 1 from Park et al., 2019
pericardial region edematous, abnormal	s843Tg + MO1-ccn1l2	standard conditions	Figure 1 from Park et al., 2019
intersegmental vessel branchiness, abnormal	s843Tg + MO1-ccn1l2	standard conditions	Figure 1 from Park et al., 2019
intersegmental vessel detached from dorsal longitudinal anastomotic vessel, abnormal	s843Tg + MO1-ccn1l2	standard conditions	Figure 1 from Park et al., 2019
dorsal longitudinal anastomotic vessel morphology, abnormal	s843Tg + MO1-ccn1l2	standard conditions	Figure 1 from Park et al., 2019
head decreased size, abnormal	s843Tg + MO1-ccn1l2	standard conditions	Figure 1 from Park et al., 2019
cranial vasculature sprouting angiogenesis process quality, abnormal	s843Tg + MO1-ccn1l2	standard conditions	Figure 1 from Park et al., 2019
intersegmental vessel morphology, abnormal	s843Tg + MO1-ccn1l2	standard conditions	Figure 1 from Park et al., 2019
trunk bent, abnormal	s843Tg + MO1-ccn1l2	standard conditions	Figure 1 from Park et al., 2019

Citations