Morpholino

MO3-cpn1

ID
ZDB-MRPHLNO-180126-1
Name
MO3-cpn1
Previous Names
  • cpn1 ATG MO (1)
Target
Sequence
5' - GAGCTGCCTGACAGCATGGTCCCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-cpn1
Expressed Gene Anatomy Figures
efnb2a Fig. 4 with image from Wu et al., 2017
eve1 Fig. 7 with image from Wu et al., 2017
flt4 Fig. 4 with image from Wu et al., 2017
hey2 Fig. 7 with image from Wu et al., 2017
id1 Fig. 7 with image from Wu et al., 2017
kdrl Fig. 4 with image from Wu et al., 2017
mrc1a Fig. 4 with image from Wu et al., 2017
stab2 Fig. 4 with image from Wu et al., 2017
Phenotype
Phenotype resulting from MO3-cpn1
Phenotype Fish Figures
blood circulation decreased process quality, abnormal sd2Tg; y1Tg + MO3-cpn1 Fig. 2 with image from Wu et al., 2017
caudal vein plexus flt4 expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
caudal vein plexus stab2 expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
caudal vein plexus mrc1a expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
caudal vein plexus kdrl expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
caudal vein plexus morphology, abnormal sd2Tg; y1Tg + MO3-cpn1 Fig. 2 with image from Wu et al., 2017
caudal vein plexus blood vessel development process quality, abnormal y1Tg + MO3-cpn1 Fig. 2 with image from Wu et al., 2017
dorsal aorta kdrl expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
dorsal aorta efnb2a expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
dorsal aorta stab2 expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
intersegmental vessel flt4 expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
intersegmental vessel kdrl expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
intersegmental vessel morphology, abnormal sd2Tg; y1Tg + MO3-cpn1 Fig. 2 with image from Wu et al., 2017
intersegmental vessel blood vessel development process quality, abnormal y1Tg + MO3-cpn1 Fig. 2 with image from Wu et al., 2017
intersegmental vessel cell migration involved in sprouting angiogenesis decreased efficacy, abnormal y1Tg + MO3-cpn1 Fig. 3 with image from Wu et al., 2017
intersegmental vessel endothelial cell decreased amount, abnormal ci5Tg; y7Tg + MO3-cpn1 Fig. 3 with image from Wu et al., 2017
intersegmental vessel sprouting angiogenesis process quality, abnormal y1Tg + MO3-cpn1 Fig. 2 with image from Wu et al., 2017
pericardial region edematous, abnormal TL + MO3-cpn1 Fig. 2 with image from Wu et al., 2017
trunk cell population proliferation decreased occurrence, abnormal la116Tg + MO3-cpn1 Fig. 3 with image from Wu et al., 2017
trunk vasculature flt4 expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
trunk vasculature kdrl expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
trunk vasculature mrc1a expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
trunk vasculature stab2 expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
trunk vasculature blood circulation decreased process quality, abnormal sd2Tg; y1Tg + MO3-cpn1 Fig. 2 with image from Wu et al., 2017
whole organism efnb2a expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
whole organism flt4 expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
whole organism id1 expression decreased amount, abnormal TL + MO3-cpn1 Fig. 7 with image from Wu et al., 2017
whole organism mrc1a expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
whole organism stab2 expression decreased amount, abnormal TL + MO3-cpn1 Fig. 4 with image from Wu et al., 2017
whole organism hey2 expression decreased amount, abnormal TL + MO3-cpn1 Fig. 7 with image from Wu et al., 2017
whole organism eve1 expression decreased amount, abnormal TL + MO3-cpn1 Fig. 7 with image from Wu et al., 2017
Phenotype of all Fish created by or utilizing MO3-cpn1
Phenotype Fish Conditions Figures
caudal vein plexus kdrl expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
whole organism mrc1a expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
whole organism stab2 expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
whole organism flt4 expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
whole organism eve1 expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 7 with image from Wu et al., 2017
whole organism id1 expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 7 with image from Wu et al., 2017
dorsal aorta stab2 expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
caudal vein plexus mrc1a expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
caudal vein plexus stab2 expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
trunk vasculature kdrl expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
intersegmental vessel kdrl expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
trunk vasculature stab2 expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
whole organism id1 expression decreased amount, abnormal TL + MO3-cpn1 chemical treatment by environment: dorsomorphin Fig. 7 with image from Wu et al., 2017
whole organism efnb2a expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
caudal vein plexus flt4 expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
dorsal aorta efnb2a expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
dorsal aorta kdrl expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
trunk vasculature flt4 expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
trunk vasculature mrc1a expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
pericardial region edematous, abnormal TL + MO3-cpn1 control Fig. 2 with image from Wu et al., 2017
whole organism hey2 expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 7 with image from Wu et al., 2017
intersegmental vessel flt4 expression decreased amount, abnormal TL + MO3-cpn1 control Fig. 4 with image from Wu et al., 2017
intersegmental vessel sprouting angiogenesis process quality, abnormal la116Tg + MO3-cpn1 chemical treatment by environment: EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor Fig. 6 with image from Wu et al., 2017
intersegmental vessel morphology, abnormal la116Tg + MO3-cpn1 chemical treatment by environment: EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor Fig. 6 with image from Wu et al., 2017
intersegmental vessel blood vessel development process quality, abnormal la116Tg + MO3-cpn1 chemical treatment by environment: EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor Fig. 6 with image from Wu et al., 2017
caudal vein plexus morphology, abnormal la116Tg + MO3-cpn1 chemical treatment by environment: EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor Fig. 6 with image from Wu et al., 2017
caudal vein plexus blood vessel development process quality, abnormal la116Tg + MO3-cpn1 chemical treatment by environment: EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor Fig. 6 with image from Wu et al., 2017
trunk cell population proliferation decreased occurrence, abnormal la116Tg + MO3-cpn1 control Fig. 3 with image from Wu et al., 2017
caudal vein plexus morphology, abnormal y1Tg + MO3-cpn1 control Fig. 2 with image from Wu et al., 2017
intersegmental vessel sprouting angiogenesis process quality, abnormal y1Tg + MO3-cpn1 control Fig. 2 with image from Wu et al., 2017
intersegmental vessel blood vessel development process quality, abnormal y1Tg + MO3-cpn1 control Fig. 2 with image from Wu et al., 2017
intersegmental vessel morphology, abnormal y1Tg + MO3-cpn1 control Fig. 2 with image from Wu et al., 2017
intersegmental vessel cell migration involved in sprouting angiogenesis decreased efficacy, abnormal y1Tg + MO3-cpn1 control Fig. 3 with image from Wu et al., 2017
caudal vein plexus blood vessel development process quality, abnormal y1Tg + MO3-cpn1 control Fig. 2 with image from Wu et al., 2017
intersegmental vessel endothelial cell decreased amount, abnormal ci5Tg; y7Tg + MO3-cpn1 control Fig. 3 with image from Wu et al., 2017
caudal vein plexus morphology, abnormal sd2Tg; y1Tg + MO3-cpn1 control Fig. 2 with image from Wu et al., 2017
blood circulation decreased process quality, abnormal sd2Tg; y1Tg + MO3-cpn1 control Fig. 2 with image from Wu et al., 2017
intersegmental vessel blood vessel development process quality, abnormal sd2Tg; y1Tg + MO3-cpn1 control Fig. 2 with image from Wu et al., 2017
intersegmental vessel sprouting angiogenesis process quality, abnormal sd2Tg; y1Tg + MO3-cpn1 control Fig. 2 with image from Wu et al., 2017
trunk vasculature blood circulation decreased process quality, abnormal sd2Tg; y1Tg + MO3-cpn1 control Fig. 2 with image from Wu et al., 2017
intersegmental vessel morphology, abnormal sd2Tg; y1Tg + MO3-cpn1 control Fig. 2 with image from Wu et al., 2017
caudal vein plexus blood vessel development process quality, abnormal sd2Tg; y1Tg + MO3-cpn1 control Fig. 2 with image from Wu et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.