Morpholino

MO2-setb

ID
ZDB-MRPHLNO-170223-1
Name
MO2-setb
Previous Names
  • MOab (1)
Target
Sequence
5' - ACTTTCGCCGCCGAGGCCGACATTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-setb
Phenotype
Phenotype resulting from MO2-setb
Phenotype Fish Figures
eye decreased size, abnormal WT + MO2-setb Fig. 5 from Serifi et al., 2016
eye deformed, abnormal WT + MO2-setb Fig. 5 from Serifi et al., 2016
head Ab1-set labeling decreased distribution, abnormal WT + MO2-setb Fig. 5 from Serifi et al., 2016
head decreased size, abnormal WT + MO2-setb Fig. 5 from Serifi et al., 2016
head shape, abnormal WT + MO2-setb Fig. 5 from Serifi et al., 2016
head apoptotic process increased occurrence, abnormal WT + MO2-setb Fig. 6 from Serifi et al., 2016
head cell population proliferation decreased occurrence, abnormal WT + MO2-setb Fig. 6 from Serifi et al., 2016
lateral line system development disrupted, abnormal WT + MO2-setb Fig. 7 from Serifi et al., 2016
neuromast decreased amount, abnormal WT + MO2-setb Fig. 7 from Serifi et al., 2016
post-vent region curved, abnormal WT + MO2-setb Fig. 5 from Serifi et al., 2016
post-vent region Ab1-set labeling decreased distribution, abnormal WT + MO2-setb Fig. 5 from Serifi et al., 2016
somite malformed, abnormal ia10Tg + MO2-setb Fig. 1-Supp with image from Serifi et al., 2021
somitogenesis decreased process quality, abnormal ia10Tg + MO2-setb Fig. 1-Supp with image from Serifi et al., 2021
trunk bent, abnormal WT + MO2-setb Fig. 5 from Serifi et al., 2016
trunk mCherry expression decreased amount, abnormal ia10Tg + MO2-setb Fig. 1-Supp with image from Serifi et al., 2021
trunk Ab1-set labeling decreased distribution, abnormal WT + MO2-setb Fig. 5 from Serifi et al., 2016
trunk apoptotic process increased occurrence, abnormal WT + MO2-setb Fig. 6 from Serifi et al., 2016
trunk cell population proliferation decreased occurrence, abnormal WT + MO2-setb Fig. 6 from Serifi et al., 2016
trunk smoothened signaling pathway decreased occurrence, abnormal ia10Tg + MO2-setb Fig. 1-Supp with image from Serifi et al., 2021
whole organism otpb expression decreased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism neurod4 expression decreased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism Ab2-set labeling decreased amount, abnormal WT + MO2-setb Fig. 5 from Serifi et al., 2016
whole organism neurod1 expression decreased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism atoh7 expression decreased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism six7 expression decreased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism crx expression decreased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism akt3b expression decreased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism otpa expression decreased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism foxi1 expression increased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism oc90 expression increased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism atoh1a expression increased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism junba expression increased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism ovol1a expression increased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism slc12a3 expression increased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism foxj1a expression increased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism cdkn1a expression increased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism optc expression increased amount, abnormal WT + MO2-setb Fig. 8 from Serifi et al., 2016
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-setb Fig. 5 from Serifi et al., 2016
Phenotype of all Fish created by or utilizing MO2-setb
Phenotype Fish Conditions Figures
whole organism slc12a3 expression increased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
trunk bent, abnormal WT + MO2-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism optc expression increased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
post-vent region curved, abnormal WT + MO2-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism six7 expression decreased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
head Ab1-set labeling decreased distribution, abnormal WT + MO2-setb standard conditions Fig. 5 from Serifi et al., 2016
head shape, abnormal WT + MO2-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism Ab2-set labeling decreased amount, abnormal WT + MO2-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism crx expression decreased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
eye deformed, abnormal WT + MO2-setb standard conditions Fig. 5 from Serifi et al., 2016
trunk Ab1-set labeling decreased distribution, abnormal WT + MO2-setb standard conditions Fig. 5 from Serifi et al., 2016
head apoptotic process increased occurrence, abnormal WT + MO2-setb standard conditions Fig. 6 from Serifi et al., 2016
trunk apoptotic process increased occurrence, abnormal WT + MO2-setb standard conditions Fig. 6 from Serifi et al., 2016
whole organism otpb expression decreased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism oc90 expression increased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism junba expression increased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
trunk cell population proliferation decreased occurrence, abnormal WT + MO2-setb standard conditions Fig. 6 from Serifi et al., 2016
whole organism cdkn1a expression increased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism ovol1a expression increased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism neurod1 expression decreased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
lateral line system development disrupted, abnormal WT + MO2-setb standard conditions Fig. 7 from Serifi et al., 2016
whole organism otpa expression decreased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
post-vent region Ab1-set labeling decreased distribution, abnormal WT + MO2-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism atoh7 expression decreased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
head cell population proliferation decreased occurrence, abnormal WT + MO2-setb standard conditions Fig. 6 from Serifi et al., 2016
head decreased size, abnormal WT + MO2-setb standard conditions Fig. 5 from Serifi et al., 2016
eye decreased size, abnormal WT + MO2-setb standard conditions Fig. 5 from Serifi et al., 2016
neuromast decreased amount, abnormal WT + MO2-setb standard conditions Fig. 7 from Serifi et al., 2016
whole organism foxi1 expression increased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism akt3b expression decreased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism neurod4 expression decreased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism foxj1a expression increased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism atoh1a expression increased amount, abnormal WT + MO2-setb standard conditions Fig. 8 from Serifi et al., 2016
somitogenesis decreased process quality, abnormal ia10Tg + MO2-setb standard conditions Fig. 1-Supp with image from Serifi et al., 2021
trunk mCherry expression decreased amount, abnormal ia10Tg + MO2-setb standard conditions Fig. 1-Supp with image from Serifi et al., 2021
somite malformed, abnormal ia10Tg + MO2-setb standard conditions Fig. 1-Supp with image from Serifi et al., 2021
trunk smoothened signaling pathway decreased occurrence, abnormal ia10Tg + MO2-setb standard conditions Fig. 1-Supp with image from Serifi et al., 2021
Citations