Morpholino

MO2-ephb3b

ID
ZDB-MRPHLNO-170201-5
Name
MO2-ephb3b
Previous Names
  • MOacc-ephb3b (1)
Target
Sequence
5' - CCCACTGCATTAAAAAAAGAGAGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ephb3b
No data available
Phenotype
Phenotype resulting from MO2-ephb3b
No data available
Phenotype of all Fish created by or utilizing MO2-ephb3b
Phenotype Fish Conditions Figures
mesoderm apical junction complex ab1-tjp1 labeling mislocalised, abnormal WT + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 5 with image from Cayuso et al., 2016
embryonic digestive tract development decreased process quality, abnormal WT + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 5 with image from Cayuso et al., 2016
intestinal bulb primordium decreased curvature, abnormal WT + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 5 with image from Cayuso et al., 2016
lateral plate mesoderm establishment of epithelial cell apical/basal polarity decreased process quality, abnormal WT + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 5 with image from Cayuso et al., 2016
hepatoblast regulation of filopodium assembly process quality, abnormal WT + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 6 with image from Cayuso et al., 2016
hepatoblast filopodium increased branchiness, abnormal WT + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 6 with image from Cayuso et al., 2016
hepatoblast mislocalised posteriorly, abnormal zf106Tg + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 4 with image from Cayuso et al., 2016
hepatoblast anterior orientation, abnormal zf106Tg + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 4 with image from Cayuso et al., 2016
embryonic digestive tract development decreased process quality, abnormal zf106Tg + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 4 with image from Cayuso et al., 2016
hepatoblast mislocalised medially, abnormal zf106Tg + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 4 with image from Cayuso et al., 2016
liver primordium malformed, abnormal zf106Tg + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 4 with image from Cayuso et al., 2016
intestinal bulb primordium decreased curvature, abnormal zf106Tg + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 4 with image from Cayuso et al., 2016
embryonic liver development process quality, abnormal zf106Tg + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 4 with image from Cayuso et al., 2016
hepatoblast shape, abnormal zf106Tg + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 4 with image from Cayuso et al., 2016
hepatocyte cell migration decreased occurrence, abnormal zf106Tg + MO1-ephb3b + MO2-ephb3b standard conditions Fig. 4 with image from Cayuso et al., 2016
Citations