Morpholino

MO1-zmiz2

ID
ZDB-MRPHLNO-150903-1
Name
MO1-zmiz2
Previous Names
None
Target
Sequence
5' - AGTCACTGCGGACAGAAACACACTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-zmiz2
Expressed Gene Anatomy Figures
ctslb Fig. 5 with image,  Fig. 7 with image from Moreno-Ayala et al., 2015
dharma Fig. 5 with image,  Fig. S5 with image from Moreno-Ayala et al., 2015
eve1 Fig. 6 with image,  Fig. S4 with image from Moreno-Ayala et al., 2015
gsc Fig. 5 with image,  Fig. 7 with image from Moreno-Ayala et al., 2015
lft1 Fig. S4 with image from Moreno-Ayala et al., 2015
noto Fig. 5 with image from Moreno-Ayala et al., 2015
otx2b Fig. 6 with image from Moreno-Ayala et al., 2015
sox32 Fig. 6 with image from Moreno-Ayala et al., 2015
tbxta Fig. 5 with image,  Fig. S3 with image from Moreno-Ayala et al., 2015
vent Fig. 5 with image from Moreno-Ayala et al., 2015
vox Fig. 5 with image from Moreno-Ayala et al., 2015
Phenotype
Phenotype resulting from MO1-zmiz2
Phenotype Fish Figures
DEL cell migration decreased rate, abnormal WT + MO1-zmiz2 Fig. 6 with image from Moreno-Ayala et al., 2015
DEL cell migration process quality, abnormal WT + MO1-zmiz2 Fig. 6 with image from Moreno-Ayala et al., 2015
dorsal/ventral pattern formation process quality, abnormal WT + MO1-zmiz2 Fig. 5 with image from Moreno-Ayala et al., 2015
endodermal cell mislocalised, abnormal WT + MO1-zmiz2 Fig. 6 with image from Moreno-Ayala et al., 2015
floor plate increased width, abnormal WT + MO1-zmiz2 + MO4-tp53 Fig. 4 with image from Moreno-Ayala et al., 2015
head cell death increased occurrence, abnormal WT + MO1-zmiz2 Fig. 2 with image,  Fig. S1 with image from Moreno-Ayala et al., 2015
notochord kinked, abnormal WT + MO1-zmiz2 Fig. 2 with image,  Fig. S1 with image from Moreno-Ayala et al., 2015
post-vent region decreased size, abnormal WT + MO1-zmiz2 + MO4-tp53 Fig. S1 with image from Moreno-Ayala et al., 2015
shield increased size, abnormal WT + MO1-zmiz2 Fig. 5 with image from Moreno-Ayala et al., 2015
trunk morphology, abnormal WT + MO1-zmiz2 + MO4-tp53 Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism curved ventral, abnormal WT + MO1-zmiz2 + MO4-tp53 Fig. 2 with image,  Fig. 8 with image,  Fig. S6 with image from Moreno-Ayala et al., 2015
whole organism elongated, abnormal WT + MO1-zmiz2 Fig. 2 with image from Moreno-Ayala et al., 2015
whole organism increased curvature, abnormal WT + MO1-zmiz2 + MO4-tp53 Fig. 2 with image,  Fig. 8 with image,  Fig. S6 with image from Moreno-Ayala et al., 2015
whole organism morphology, abnormal WT + MO1-zmiz2 Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism ovate, abnormal WT + MO1-zmiz2 Fig. 2 with image from Moreno-Ayala et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-zmiz2 + MO4-tp53 Fig. S1 with image from Moreno-Ayala et al., 2015
Phenotype of all Fish created by or utilizing MO1-zmiz2
Phenotype Fish Conditions Figures
shield increased size, abnormal WT + MO1-zmiz2 standard conditions Fig. 5 with image from Moreno-Ayala et al., 2015
post-vent region decreased size, abnormal WT + MO1-zmiz2 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism elongated, abnormal WT + MO1-zmiz2 standard conditions Fig. 2 with image from Moreno-Ayala et al., 2015
head cell death increased occurrence, abnormal WT + MO1-zmiz2 standard conditions Fig. 2 with image,  Fig. S1 with image from Moreno-Ayala et al., 2015
DEL cell migration decreased rate, abnormal WT + MO1-zmiz2 standard conditions Fig. 6 with image from Moreno-Ayala et al., 2015
whole organism increased curvature, abnormal WT + MO1-zmiz2 standard conditions Fig. 2 with image from Moreno-Ayala et al., 2015
whole organism ovate, abnormal WT + MO1-zmiz2 standard conditions Fig. 2 with image from Moreno-Ayala et al., 2015
notochord kinked, abnormal WT + MO1-zmiz2 standard conditions Fig. 2 with image,  Fig. S1 with image from Moreno-Ayala et al., 2015
endodermal cell mislocalised, abnormal WT + MO1-zmiz2 standard conditions Fig. 6 with image from Moreno-Ayala et al., 2015
trunk morphology, abnormal WT + MO1-zmiz2 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
dorsal/ventral pattern formation process quality, abnormal WT + MO1-zmiz2 standard conditions Fig. 5 with image from Moreno-Ayala et al., 2015
DEL cell migration process quality, abnormal WT + MO1-zmiz2 standard conditions Fig. 6 with image from Moreno-Ayala et al., 2015
whole organism curved ventral, abnormal WT + MO1-zmiz2 standard conditions Fig. 2 with image from Moreno-Ayala et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-zmiz2 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism morphology, abnormal WT + MO1-zmiz2 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
post-vent region decreased size, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
floor plate increased width, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. 4 with image from Moreno-Ayala et al., 2015
notochord kinked, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism increased curvature, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. 2 with image,  Fig. 8 with image,  Fig. S6 with image from Moreno-Ayala et al., 2015
whole organism curved ventral, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. 2 with image,  Fig. 8 with image,  Fig. S6 with image from Moreno-Ayala et al., 2015
trunk morphology, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism morphology, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S6 with image from Moreno-Ayala et al., 2015
whole organism physical object quality, abnormal WT + MO1-tdgf1 + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S6 with image from Moreno-Ayala et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.