Morpholino

MO1-pigp

ID
ZDB-MRPHLNO-150402-5
Name
MO1-pigp
Previous Names
  • dscr5 MO1 (1)
Target
Sequence
5' - GAGGAGAAGGAGAGTTCTCCACCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pigp
Expressed Gene Anatomy Figures
chrd Fig. 4 with image from Shao et al., 2009
ctslb Fig. 1 with image from Shao et al., 2009
dlx3b Fig. 1 with image,  Fig. 5 with image,  Fig. 7 with image from Shao et al., 2009
eve1 Fig. 4 with image from Shao et al., 2009
myod1 Fig. 7 with image from Shao et al., 2009
nkx2.1 Fig. 4 with image from Shao et al., 2009
nkx2.2a Fig. 4 with image from Shao et al., 2009
pcdh8 Fig. 1 with image from Shao et al., 2009
ptch1 Fig. 4 with image from Shao et al., 2009
tbxta Fig. 1 with image,  Fig. 4 with image from Shao et al., 2009
Phenotype
Phenotype resulting from MO1-pigp
Phenotype Fish Figures
axis shortened, abnormal WT + MO1-pigp Fig. 1 with image from Shao et al., 2009
caudal fin folded, abnormal WT + MO1-pigp Fig. 7 with image from Shao et al., 2009
convergent extension process quality, abnormal WT + MO1-pigp Fig. 1 with image,  Fig. 3 with image,  Fig. 7 with image from Shao et al., 2009
convergent extension involved in axis elongation process quality, abnormal WT + MO1-pigp Fig. 1 with image,  Fig. 7 with image from Shao et al., 2009
convergent extension involved in neural plate elongation process quality, abnormal WT + MO1-pigp Fig. 1 with image from Shao et al., 2009
hypoblast convergent extension process quality, abnormal WT + MO1-pigp Fig. 3 with image from Shao et al., 2009
JNK cascade decreased process quality, abnormal WT + MO1-pigp Fig. 5 with image from Shao et al., 2009
mediolateral intercalation process quality, abnormal WT + MO1-pigp Fig. 3 with image from Shao et al., 2009
neural plate increased width, abnormal WT + MO1-pigp Fig. 1 with image from Shao et al., 2009
notochord increased width, abnormal WT + MO1-pigp Fig. 3 with image from Shao et al., 2009
notochord cell circular, abnormal WT + MO1-pigp Fig. 3 with image from Shao et al., 2009
Phenotype of all Fish created by or utilizing MO1-pigp
Phenotype Fish Conditions Figures
hypoblast convergent extension process quality, abnormal WT + MO1-pigp standard conditions Fig. 3 with image from Shao et al., 2009
notochord cell circular, abnormal WT + MO1-pigp standard conditions Fig. 3 with image from Shao et al., 2009
convergent extension process quality, abnormal WT + MO1-pigp standard conditions Fig. 1 with image,  Fig. 3 with image,  Fig. 7 with image from Shao et al., 2009
convergent extension involved in neural plate elongation process quality, abnormal WT + MO1-pigp standard conditions Fig. 1 with image from Shao et al., 2009
notochord increased width, abnormal WT + MO1-pigp standard conditions Fig. 3 with image from Shao et al., 2009
axis shortened, abnormal WT + MO1-pigp standard conditions Fig. 1 with image from Shao et al., 2009
convergent extension involved in axis elongation process quality, abnormal WT + MO1-pigp standard conditions Fig. 1 with image,  Fig. 7 with image from Shao et al., 2009
mediolateral intercalation process quality, abnormal WT + MO1-pigp standard conditions Fig. 3 with image from Shao et al., 2009
JNK cascade decreased process quality, abnormal WT + MO1-pigp standard conditions Fig. 5 with image from Shao et al., 2009
neural plate increased width, abnormal WT + MO1-pigp standard conditions Fig. 1 with image from Shao et al., 2009
caudal fin folded, abnormal WT + MO1-pigp standard conditions Fig. 7 with image from Shao et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.