Morpholino

MO1-prmt6

ID
ZDB-MRPHLNO-141215-14
Name
MO1-prmt6
Previous Names
None
Target
Sequence
5' - GGCCATGCGTCTTTAGTTTTTCCAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prmt6
Expressed Gene Anatomy Figures
cdkn1a Fig. 4 from Zhao et al., 2016
eve1 Fig. 3 from Zhao et al., 2016
gadd45aa Fig. 3,  Fig. 4 from Zhao et al., 2016
hsp70.3 Fig. 3 from Zhao et al., 2016
jun Fig. 4 from Zhao et al., 2016
rx3 Fig. 3 from Zhao et al., 2016
sox2 Fig. 3 from Zhao et al., 2016
tbpl2 Fig. 3 from Zhao et al., 2016
tp53 Fig. 4 from Zhao et al., 2016
Phenotype
Phenotype resulting from MO1-prmt6
Phenotype Fish Figures
apoptotic process process quality, abnormal AB + MO1-prmt6 Fig. 4 from Zhao et al., 2016
epiboly process quality, abnormal AB + MO1-prmt6 + MO4-tp53 Fig. 2,  Fig. 3,  Fig. 4 from Zhao et al., 2016
whole organism ab12-tp53 labeling amount, ameliorated AB + MO1-prmt6 + MO4-tp53 Fig. 2 from Zhao et al., 2016
whole organism eve1 expression decreased amount, abnormal AB + MO1-prmt6 Fig. 3 from Zhao et al., 2016
whole organism Ab43-h3 labeling decreased amount, abnormal AB + MO1-prmt6 Fig. 2 from Zhao et al., 2016
whole organism sox2 expression decreased amount, abnormal AB + MO1-prmt6 Fig. 3 from Zhao et al., 2016
whole organism hsp70.3 expression increased amount, abnormal AB + MO1-prmt6 Fig. 3 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 Fig. 3,  Fig. 4 from Zhao et al., 2016
whole organism tp53 expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 Fig. 4 from Zhao et al., 2016
whole organism cdkn1a expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 Fig. 4 from Zhao et al., 2016
whole organism rx3 expression increased amount, abnormal AB + MO1-prmt6 Fig. 3 from Zhao et al., 2016
whole organism tbpl2 expression increased amount, abnormal AB + MO1-prmt6 Fig. 3 from Zhao et al., 2016
whole organism jun expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 Fig. 4 from Zhao et al., 2016
whole organism ab12-tp53 labeling increased amount, abnormal AB + MO1-prmt6 Fig. 2 from Zhao et al., 2016
Phenotype of all Fish created by or utilizing MO1-prmt6
Phenotype Fish Conditions Figures
whole organism sox2 expression decreased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 3 from Zhao et al., 2016
whole organism ab12-tp53 labeling increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 2 from Zhao et al., 2016
epiboly process quality, abnormal AB + MO1-prmt6 standard conditions Fig. 2,  Fig. 3,  Fig. 4 from Zhao et al., 2016
whole organism rx3 expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 3 from Zhao et al., 2016
epiboly process quality, ameliorated AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one, chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
whole organism tp53 expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 4 from Zhao et al., 2016
whole organism jun expression amount, ameliorated AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one, chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
apoptotic process process quality, ameliorated AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one, chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
whole organism cdkn1a expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 4 from Zhao et al., 2016
epiboly process quality, ameliorated AB + MO1-prmt6 chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 3,  Fig. 4 from Zhao et al., 2016
whole organism eve1 expression decreased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 3 from Zhao et al., 2016
whole organism jun expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 4 from Zhao et al., 2016
whole organism tbpl2 expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 3 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one, chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
epiboly process quality, ameliorated AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one Fig. 4 from Zhao et al., 2016
whole organism cdkn1a expression amount, ameliorated AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one, chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
whole organism hsp70.3 expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 3 from Zhao et al., 2016
whole organism tp53 expression amount, ameliorated AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one, chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
apoptotic process process quality, abnormal AB + MO1-prmt6 standard conditions Fig. 4 from Zhao et al., 2016
whole organism Ab43-h3 labeling decreased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 2 from Zhao et al., 2016
epiboly process quality, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
apoptotic process process quality, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism tp53 expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism cdkn1a expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism ab12-tp53 labeling amount, ameliorated AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
whole organism jun expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
epiboly process quality, abnormal AB + MO1-hsp70l + MO1-prmt6 standard conditions Fig. 3 from Zhao et al., 2016
epiboly process quality, abnormal AB + MO1-prmt6 + MO2-tbpl2 standard conditions Fig. 3 from Zhao et al., 2016
epiboly process quality, ameliorated AB + MO1-prmt6 + MO3-gadd45aa standard conditions Fig. 3 from Zhao et al., 2016
whole organism cdkn1a expression amount, ameliorated AB + MO1-prmt6 + MO3-gadd45aa standard conditions Fig. 4 from Zhao et al., 2016
apoptotic process process quality, ameliorated AB + MO1-prmt6 + MO3-gadd45aa standard conditions Fig. 4 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO1-prmt6 + MO3-gadd45aa standard conditions Fig. 4 from Zhao et al., 2016
whole organism jun expression amount, ameliorated AB + MO1-prmt6 + MO3-gadd45aa standard conditions Fig. 4 from Zhao et al., 2016
whole organism tp53 expression amount, ameliorated AB + MO1-prmt6 + MO3-gadd45aa standard conditions Fig. 4 from Zhao et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.