Morpholino

MO3-sulf1

ID
ZDB-MRPHLNO-140321-1
Name
MO3-sulf1
Previous Names
  • S1-ATG (1)
Target
Sequence
5' - CACCAGCTGCATCATGGGACTGCGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sulf1
Phenotype
Phenotype resulting from MO3-sulf1
Phenotype Fish Figures
axial vasculature blood circulation disrupted, abnormal WT + MO3-sulf1 Fig. 4 from Gorsi et al., 2014
blood accumulation caudal vein plexus, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S5 from Gorsi et al., 2014
blood circulation disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S3 from Gorsi et al., 2014
blood vessel lumenization disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 5 from Gorsi et al., 2014
caudal artery immature, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 5 from Gorsi et al., 2014
caudal artery morphology, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 5 from Gorsi et al., 2014
caudal vein plexus disorganized, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 5 from Gorsi et al., 2014
central artery immature, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S3 from Gorsi et al., 2014
central artery blood vessel lumenization disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 5 from Gorsi et al., 2014
cranial vasculature broken, abnormal s844Tg + MO3-sulf1 Fig. S6 from Gorsi et al., 2014
cranial vasculature lacks parts or has fewer parts of type central artery, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S3Fig. S5 from Gorsi et al., 2014
cranial vasculature blood circulation disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 3Fig. 4Fig. S5 from Gorsi et al., 2014
dorsal aorta blood circulation disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S5 from Gorsi et al., 2014
head hemorrhagic, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 1Fig. S3 from Gorsi et al., 2014
heparan sulfate 6-sulfotransferase activity process quality, abnormal WT + MO3-sulf1 Fig. 2 from Gorsi et al., 2014
hindbrain edematous, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S3 from Gorsi et al., 2014
hindbrain morphology, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 1 from Gorsi et al., 2014
post-vent region edematous, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 1 from Gorsi et al., 2014
post-vent vasculature blood circulation disrupted, abnormal sd2Tg + MO3-sulf1 Fig. 3 from Gorsi et al., 2014
spinal cord curved, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S3 from Gorsi et al., 2014
Phenotype of all Fish created by or utilizing MO3-sulf1
Phenotype Fish Conditions Figures
axial vasculature blood circulation disrupted, abnormal WT + MO3-sulf1 standard conditions Fig. 4 from Gorsi et al., 2014
heparan sulfate 6-sulfotransferase activity process quality, abnormal WT + MO3-sulf1 standard conditions Fig. 2 from Gorsi et al., 2014
cranial vasculature blood circulation disrupted, abnormal WT + MO3-sulf1 standard conditions Fig. 4 from Gorsi et al., 2014
cranial vasculature broken, abnormal s844Tg + MO3-sulf1 standard conditions Fig. S6 from Gorsi et al., 2014
post-vent vasculature blood circulation disrupted, abnormal sd2Tg + MO3-sulf1 standard conditions Fig. 3 from Gorsi et al., 2014
cranial vasculature blood circulation disrupted, abnormal sd2Tg + MO3-sulf1 standard conditions Fig. 3Fig. S5 from Gorsi et al., 2014
head hemorrhagic, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 1Fig. S3 from Gorsi et al., 2014
blood circulation disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S3 from Gorsi et al., 2014
dorsal aorta blood circulation disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S5 from Gorsi et al., 2014
blood accumulation caudal vein plexus, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S5 from Gorsi et al., 2014
blood vessel lumenization disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 5 from Gorsi et al., 2014
hindbrain edematous, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S3 from Gorsi et al., 2014
caudal vein plexus disorganized, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 5 from Gorsi et al., 2014
cranial vasculature lacks parts or has fewer parts of type central artery, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S3Fig. S5 from Gorsi et al., 2014
caudal artery morphology, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 5 from Gorsi et al., 2014
post-vent region edematous, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 1 from Gorsi et al., 2014
caudal artery immature, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 5 from Gorsi et al., 2014
hindbrain morphology, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 1 from Gorsi et al., 2014
cranial vasculature blood circulation disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S5 from Gorsi et al., 2014
spinal cord curved, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S3 from Gorsi et al., 2014
central artery immature, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S3 from Gorsi et al., 2014
central artery blood vessel lumenization disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 5 from Gorsi et al., 2014
Citations