Morpholino

MO2-vsx1

ID
ZDB-MRPHLNO-140307-1
Name
MO2-vsx1
Previous Names
None
Target
Sequence
5' - TGTAGCTTCTTCTCTTCCCGTCATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-vsx1
Expressed Gene Anatomy Figures
bmp2b Fig. 6 with image from He et al., 2014
ctslb Fig. 1 with imageFig. 5 with image from Xu et al., 2014
dkk1b Fig. 6 with image from Xu et al., 2014
dlx3b Fig. 1 with image from Xu et al., 2014
egr2b Fig. 4 with image from Xu et al., 2014
en2a Fig. 4 with image from Xu et al., 2014
gsc Fig. 2 with imageFig. 6 with image from Xu et al., 2014
hoxb1b Fig. 4 with image from Xu et al., 2014
msgn1 Fig. 3 with image from He et al., 2014
myod1 Fig. 2 with image from He et al., 2014
noto Fig. 5 with image from He et al., 2014
otx2b Fig. 6 with image from Xu et al., 2014
pax2a Fig. 4 with image from Xu et al., 2014
pcdh8 Fig. 5 with image from He et al., 2014
rx3 Fig. 4 with imageFig. 5 with image from Xu et al., 2014
six3b Fig. 4 with imageFig. 6 with image from Xu et al., 2014
tbx6 Fig. 3 with image from He et al., 2014
tbx16 Fig. 5 with image from He et al., 2014
tbxta Fig. 2 with image from He et al., 2014
Fig. 1 with imageFig. 2 with imageFig. 7 with image from Xu et al., 2014
vent Fig. 6 with image from He et al., 2014
vox Fig. 6 with image from He et al., 2014
vsx1 Fig. 4 with image from He et al., 2014
wnt8a Fig. 6 with image from He et al., 2014
Phenotype
Phenotype resulting from MO2-vsx1
Phenotype of all Fish created by or utilizing MO2-vsx1
Phenotype Fish Conditions Figures
prechordal plate mesodermal cell migration process quality, abnormal WT + MO2-vsx1 standard conditions Fig. 2 with image from Xu et al., 2014
axial mesoderm formation process quality, abnormal WT + MO2-vsx1 standard conditions Fig. 2 with image from He et al., 2014
somite absent, abnormal WT + MO2-vsx1 standard conditions Fig. 1 with image from He et al., 2014
whole organism decreased life span, abnormal WT + MO2-vsx1 standard conditions Fig. 1 with image from He et al., 2014
paraxial mesoderm formation process quality, abnormal WT + MO2-vsx1 standard conditions Fig. 2 with image from He et al., 2014
ventricular system morphology, abnormal WT + MO2-vsx1 standard conditions Fig. 3 with image from Xu et al., 2014
brain morphology, abnormal WT + MO2-vsx1 standard conditions Fig. 3 with image from Xu et al., 2014
prechordal plate formation process quality, abnormal WT + MO2-vsx1 standard conditions Fig. 1 with imageFig. 2 with imageFig. 5 with image from Xu et al., 2014
spinal cord bifurcated, abnormal WT + MO2-vsx1 standard conditions Fig. 1 with image from He et al., 2014
forebrain development process quality, abnormal WT + MO2-vsx1 standard conditions Fig. 4 with imageFig. 5 with image from Xu et al., 2014
anatomical structure dorso-medial region disorganized, abnormal WT + MO2-vsx1 standard conditions Fig. 1 with image from He et al., 2014
whole organism wholly dorsalized, abnormal WT + MO2-vsx1 standard conditions Fig. 1 with image from He et al., 2014
Fig. 3 with image from Xu et al., 2014
notochord morphology, abnormal WT + MO2-vsx1 + MO4-tbxta standard conditions Fig. 3 with image from Xu et al., 2014
Citations