Morpholino

MO3-hspb7

ID

ZDB-MRPHLNO-140128-3

Name

MO3-hspb7

Previous Names

exon1/intron1 (1)

Target

hspb7 (1)

Sequence

5' - TGCATATAGCTTTCCACTCACTTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-hspb7

Expressed Gene	Anatomy	Figures
foxa3	gut liver pancreatic bud	Fig. 6 from Lahvic et al., 2013
lft1	diencephalon left side Kupffer's vesicle anatomical region notochord	Fig. 4 from Lahvic et al., 2013
lft2	heart primordium left side	Fig. 4 from Lahvic et al., 2013
myl7	atrium cardiac ventricle primitive heart tube	Fig. 2 , Fig. 6 from Lahvic et al., 2013
pitx2	lateral plate mesoderm right side	Fig. 4 from Lahvic et al., 2013
spaw	lateral plate mesoderm left side	Fig. 4 from Lahvic et al., 2013

Phenotype

Phenotype resulting from MO3-hspb7

Phenotype	Fish	Figures
determination of digestive tract left/right asymmetry process quality, abnormal	WT + MO3-hspb7	Fig. 6 from Lahvic et al., 2013
embryonic heart tube left/right pattern formation process quality, abnormal	WT + MO3-hspb7	Fig. 6 from Lahvic et al., 2013
heart jogging process quality, abnormal	WT + MO3-hspb7	Fig. 2 , Fig. 3 from Lahvic et al., 2013
heart rudiment displaced to whole organism right side, abnormal	WT + MO3-hspb7	Fig. 2 , Fig. 3 from Lahvic et al., 2013
heart rudiment displaced to whole organism axis, abnormal	WT + MO3-hspb7	Fig. 2 , Fig. 3 from Lahvic et al., 2013
heart rudiment malformed, abnormal	WT + MO3-hspb7	Fig. 2 from Lahvic et al., 2013
Kupffer's vesicle lacks parts or has fewer parts of type Kupffer's vesicle motile cilium, abnormal	WT + MO3-hspb7	Fig. 7 from Lahvic et al., 2013
Kupffer's vesicle cilium movement process quality, abnormal	WT + MO3-hspb7	Fig. 7 from Lahvic et al., 2013
Kupffer's vesicle motile cilium immobile, abnormal	WT + MO3-hspb7	Fig. 7 from Lahvic et al., 2013
Kupffer's vesicle motile cilium lacks parts or has fewer parts of type Kupffer's vesicle axonemal central pair, abnormal	WT + MO3-hspb7	Fig. 7 from Lahvic et al., 2013
Kupffer's vesicle motile cilium malformed, abnormal	WT + MO3-hspb7	Fig. 7 from Lahvic et al., 2013
left/right pattern formation process quality, abnormal	WT + MO3-hspb7	Fig. 4 , Fig. 6 from Lahvic et al., 2013
whole organism curved ventral, abnormal	WT + MO3-hspb7	Fig. 2 from Lahvic et al., 2013

Phenotype of all Fish created by or utilizing MO3-hspb7

Phenotype	Fish	Conditions	Figures
determination of digestive tract left/right asymmetry process quality, abnormal	WT + MO3-hspb7	standard conditions	Fig. 6 from Lahvic et al., 2013
heart jogging process quality, abnormal	WT + MO3-hspb7	standard conditions	Fig. 2 , Fig. 3 from Lahvic et al., 2013
whole organism curved ventral, abnormal	WT + MO3-hspb7	standard conditions	Fig. 2 from Lahvic et al., 2013
heart rudiment malformed, abnormal	WT + MO3-hspb7	standard conditions	Fig. 2 from Lahvic et al., 2013
heart rudiment displaced to whole organism axis, abnormal	WT + MO3-hspb7	standard conditions	Fig. 2 , Fig. 3 from Lahvic et al., 2013
Kupffer's vesicle motile cilium malformed, abnormal	WT + MO3-hspb7	standard conditions	Fig. 7 from Lahvic et al., 2013
embryonic heart tube left/right pattern formation process quality, abnormal	WT + MO3-hspb7	standard conditions	Fig. 6 from Lahvic et al., 2013
Kupffer's vesicle motile cilium lacks parts or has fewer parts of type Kupffer's vesicle axonemal central pair, abnormal	WT + MO3-hspb7	standard conditions	Fig. 7 from Lahvic et al., 2013
left/right pattern formation process quality, abnormal	WT + MO3-hspb7	standard conditions	Fig. 4 , Fig. 6 from Lahvic et al., 2013
Kupffer's vesicle cilium movement process quality, abnormal	WT + MO3-hspb7	standard conditions	Fig. 7 from Lahvic et al., 2013
heart rudiment displaced to whole organism right side, abnormal	WT + MO3-hspb7	standard conditions	Fig. 2 , Fig. 3 from Lahvic et al., 2013
Kupffer's vesicle lacks parts or has fewer parts of type Kupffer's vesicle motile cilium, abnormal	WT + MO3-hspb7	standard conditions	Fig. 7 from Lahvic et al., 2013
Kupffer's vesicle motile cilium immobile, abnormal	WT + MO3-hspb7	standard conditions	Fig. 7 from Lahvic et al., 2013
Kupffer's vesicle motile cilium lacks parts or has fewer parts of type Kupffer's vesicle axonemal central pair, abnormal	WT + MO3-hspb7 + MO4-hspb7	standard conditions	Fig. 7 from Lahvic et al., 2013
heart rudiment displaced to whole organism right side, abnormal	WT + MO3-hspb7 + MO4-hspb7	standard conditions	Fig. 2 from Lahvic et al., 2013
heart rudiment split bilaterally, abnormal	WT + MO3-hspb7 + MO4-hspb7	standard conditions	Fig. 2 from Lahvic et al., 2013
heart rudiment displaced to whole organism axis, abnormal	WT + MO3-hspb7 + MO4-hspb7	standard conditions	Fig. 2 from Lahvic et al., 2013
heart rudiment malformed, abnormal	WT + MO3-hspb7 + MO4-hspb7	standard conditions	Fig. 2 from Lahvic et al., 2013
heart jogging process quality, abnormal	WT + MO3-hspb7 + MO4-hspb7	standard conditions	Fig. 2 from Lahvic et al., 2013
Kupffer's vesicle motile cilium malformed, abnormal	WT + MO3-hspb7 + MO4-hspb7	standard conditions	Fig. 7 from Lahvic et al., 2013
heart jogging process quality, abnormal	WT + MO3-hspb12 + MO3-hspb7	standard conditions	Fig. 3 from Lahvic et al., 2013
heart rudiment displaced to whole organism right side, abnormal	WT + MO3-hspb12 + MO3-hspb7	standard conditions	Fig. 3 from Lahvic et al., 2013
heart rudiment displaced to whole organism axis, abnormal	WT + MO3-hspb12 + MO3-hspb7	standard conditions	Fig. 3 from Lahvic et al., 2013
left/right pattern formation process quality, abnormal	WT + MO3-hspb12 + MO3-hspb7	standard conditions	Fig. 5 from Lahvic et al., 2013

Citations