Morpholino

MO3-socs1a

ID
ZDB-MRPHLNO-130214-4
Name
MO3-socs1a
Previous Names
None
Target
Sequence
5' - TGCGCCACCATCCTACAGGAAAGAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-socs1a
Expressed Gene Anatomy Figures
ccr9a Fig. 5 with image from Lawir et al., 2017
ccr9b Fig. 5 with image from Lawir et al., 2017
rag1 Fig. 3 with image,  Fig. 5 with image from Lawir et al., 2017
socs1a Fig. 4 with image from Yin et al., 2012
Phenotype
Phenotype resulting from MO3-socs1a
Phenotype Fish Figures
eye apoptotic, abnormal WT + MO3-socs1a Fig. 4 with image,  Fig. 5 with image from Yin et al., 2012
eye decreased size, abnormal WT + MO3-socs1a Fig. 4 with image,  Fig. 5 with image from Yin et al., 2012
T cell differentiation decreased occurrence, abnormal TU + MO3-socs1a Fig. 3 with image from Lawir et al., 2017
T cell migration decreased occurrence, abnormal fr101Tg + MO3-socs1a Fig. 4 with image from Lawir et al., 2017
thymus lymphoid progenitor cell decreased amount, abnormal fr101Tg + MO3-socs1a Fig. 4 with image from Lawir et al., 2017
thymus T cell rag1 expression decreased amount, abnormal TU + MO3-socs1a Fig. 3 with image from Lawir et al., 2017
whole organism rag1 expression decreased amount, abnormal TU + MO3-socs1a Fig. 3 with image,  Fig. 5 with image from Lawir et al., 2017
whole organism ccr9b expression decreased amount, abnormal TU + MO3-socs1a Fig. 5 with image from Lawir et al., 2017
whole organism ccr9a expression decreased amount, abnormal TU + MO3-socs1a Fig. 5 with image from Lawir et al., 2017
Phenotype of all Fish created by or utilizing MO3-socs1a
Phenotype Fish Conditions Figures
thymus T cell rag1 expression decreased amount, abnormal TU + MO3-socs1a standard conditions Fig. 3 with image from Lawir et al., 2017
whole organism ccr9b expression decreased amount, abnormal TU + MO3-socs1a standard conditions Fig. 5 with image from Lawir et al., 2017
whole organism ccr9a expression decreased amount, abnormal TU + MO3-socs1a standard conditions Fig. 5 with image from Lawir et al., 2017
T cell differentiation decreased occurrence, abnormal TU + MO3-socs1a standard conditions Fig. 3 with image from Lawir et al., 2017
whole organism rag1 expression decreased amount, abnormal TU + MO3-socs1a standard conditions Fig. 3 with image,  Fig. 5 with image from Lawir et al., 2017
eye apoptotic, abnormal WT + MO3-socs1a standard conditions Fig. 4 with image,  Fig. 5 with image from Yin et al., 2012
eye decreased size, abnormal WT + MO3-socs1a standard conditions Fig. 4 with image,  Fig. 5 with image from Yin et al., 2012
T cell migration decreased occurrence, abnormal fr101Tg + MO3-socs1a standard conditions Fig. 4 with image from Lawir et al., 2017
thymus lymphoid progenitor cell decreased amount, abnormal fr101Tg + MO3-socs1a standard conditions Fig. 4 with image from Lawir et al., 2017
eye decreased size, abnormal nt11Tg + MO3-socs1a standard conditions Fig. 5 with image from Yin et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.